|
|
||||||||

,
* Department of Biological Sciences, College of Optometry, State University of New York, New York, New York 10036; Departments of
Ophthalmology and
Department of Physiology and Cellular Biophysics, College of Physicians and Surgeons, Columbia University, New York, New York 10032
| Abstract |
|---|
|
|
|---|
Key Words: corneal epithelium corneal endothelial cells Na:K:2Cl cotransporter gene expression cell passage
| Introduction |
|---|
|
|
|---|
A common characteristic of corneal epithelial and endothelial transport physiology is that each of these tissues exhibits secondary active chloride transport, which is in part dependent on the parallel activity of the Na:K pump and an NKCC. In the epithelium, expression of these transporters results in Cl secretion from the stromal to the tear side, whereas in the endothelium this process presumably contributes to net Cl flux from the stroma towards the anterior chamber. In other tissues mediating either absorptive or secretory chloride transport, a specific NKCC isoform is usually expressed in connection with each type of these processes. In a secretory tissue, the isoform is designated NKCC1. The gene-specific transcript encoding for these proteins is about 7.4 kb (2). On the other hand, in the medullary regions of the kidney absorptive chloride transport is mediated by another isoform, NKCC2. The mRNA encoding this protein is about 5 kb. These two isoforms have an overall amino acid identity of 55% to 65%, whereas in the highly conserved transmembrane regions it ranges between 75% to 90% (3). In freshly isolated bovine corneal epithelial and endothelial cells, an NKCC protein has been detected and its expression is apparently higher in the fresh cells than in their cultured counterpart (4). However, there is no information regarding possible expression of two different NKCC proteins and gene-specific encoding mRNA transcripts in either corneal epithelial or endothelial cells; and whether NKCC gene and protein expression is different in fresh tissue than in their cultured counterpart.
Glucose availability plays a critical role in the maintenance of numerous corneal endothelial and epithelial functions. It is well established in these tissues that glucose uptake occurs through a facilitative transport process involving the GLUT. After corneal epithelial wounding, mRNA and protein expression is rapidly enhanced for one of the GLUT isoforms, GLUT1 (5). This effect indicates that increases in intracellular glucose levels are needed to meet the energetic requirements of cell migration and proliferation. In addition, GLUTs may be involved in the maintenance of cell homeostasis because in the presence of an osmotic gradient, facilitative GLUTs act as a minor transmembrane pathway for water flow (6). As with the NKCC, there is no information comparing GLUT1 gene expression levels in freshly isolated corneal tissue with its tissue culture counterpart.
Corneal transparency maintenance depends on appropriate levels of transendothelial fluid transport. In addition, there is some evidence that the epithelium may play a minor role in dehydrating the stroma (7). In each of these tissues, specific aquaporin isoforms serve as conduits for osmotic fluid flows and perhaps for CO2 flows (810). Five homologs of aquaporin (AQP15) have been identified in various mammalian tissues. In rat cornea, RT-PCR studies show that AQP1 expression is approximately 3-fold higher than AQP3 and 2.5-fold higher than AQP5 (11). In the rat corneal endothelium, AQP1 expression has been identified, whereas in its epithelial layer AQP3 and 5 are prominently expressed (12). However, there is no information regarding AQP isoform mRNA expression in bovine corneal layers.
Here we compare the levels of AQP1, GLUT1, and NKCC mRNA and NKCC protein expression in freshly isolated bovine corneal epithelium and endothelium with those in cultured cells. As a function of cell passage, these levels declined, suggesting that mRNA expression levels in cell culture may not be reflective of those in these freshly isolated tissues. In addition, some suggestive evidence is provided that there are two different NKCC mRNAs that encode for two NKCC protein isoforms. Finally, a novel approach is described, allowing measurement of mRNA abundance in small amounts of tissues, which avoids reliance on cell cultures to make such a determination.
| Material and Methods |
|---|
|
|
|---|
Materials.
Bovine eyes obtained from a local slaughterhouse were placed on ice and were washed with physiological saline, after which their corneas were excised. Only one of the two limiting corneal layers was harvested from a given cornea. Endothelial layers were harvested at 25°C by placing the corneas epithelial side down on watchglasses, after which the endothelial layer was exposed for 2 min to 200 l of lysate solution (LS) (see below). Epithelial layers were harvested by gently everting the corneas, placing them endothelial side down in the same watchglasses, and exposing them similarly to LS. For a given experimental series, we pooled five preparations. CBCEn cells were from the third to fifth passages. These cells were harvested by lysing them with 1 ml of LS; the contents of one flask sufficed for an experimental series. Lysates were analyzed immediately or stored at -70°C in the same LS.
Solutions.
LS was 5 M guanidine thiocyanate (GuSCN) and 0.1 M EDTA; hybridization buffer (HB) was 2x standard saline citrate (SCC) plus 0.1 M EDTA. They were sterilized by filtering through a 0.2-µm Sterile Acrodisc (Gelman Sciences, Ann Arbor, MI), and were stored at room temperature. To protect against RNase contamination, water for all solutions was treated with 0.2% diethyl pyrocarbonate (Sigma, St. Louis, MO), followed by stirring overnight and autoclaving. For the S1 nuclease buffer, a stock solution was made containing 0.56 M NaCl, 9 mM ZnSO4, and 0.1 M sodium acetate (pretitrated to pH 4.5), sterilized as above, and stored at 4°C. Immediately prior to an experiment, 2000 units/ml S1 nuclease (Sigma) and 20 µg/ml denatured salmon sperm DNA (Sigma) were added.
Determination of Cell Lysates DNA Contents.
As standards, DNA from
5 million CBCEn cells was purified using the Puregene kit (Gentra Systems Inc., Minneapolis, MN) and the sample DNA concentration was determined with a spectrophotometer (Gene-Quant, Pharmacia Biotech, Piscataway, NJ). DNA from 20-µl samples of cell lysates was similarly purified. Several dilutions of cell lysates and of standard DNA sample were denatured with 0.1N NaOH and placed on a nylon membrane (Hybond N+, Amersham, Arlington Heights, IL). After cross-linking by UV, the samples were hybridized with random primer extension-generated (Megaprime DNA labeling system, Amersham) 32P-labeled (with
-32P dATP, New England Nuclear, Boston, MA) total DNA probes. Dots were visualized (Fig. 1A
) by exposure to X-ray film (Kodak XAR-2, Eastman Kodak, Rochester, NY), after which the dots were cut and their radioactivity was quantitated by scintillation counting. The radioactivity of the DNA standards was plotted against their DNA amounts, and was fitted to a function (Fig. 1B
). The procedure was repeated with similar results, enabling such a calibration curve to be used to quantify the DNA contents in 20-µl aliquots. As an additional precaution, use of the calibration curve was limited to that in its near-linear segment. The protein content of these aliquots was determined by Coomassie Protein Assay (Pierce, Rockford, IL). The protein/DNA ratios in each of the tissues were determined so as to use a constant number of cells in all the different experiments.
|
2 hr in Rapid-Hyb Buffer (Amersham)/50% formamide at 45°C. Overnight hybridization was carried out under the same conditions with random primer extension-generated shark NKCC1 probe (
5 x 106 cpm/ml). To evaluate the specificity of our NKCC1 probe as well as to discriminate between NKCC1 and its homologues that are possibly expressed and hybridize with this probe, we used both mid- and high-stringency washes. The membranes were washed by shaking as follows: (A) Mid-stringency, 2x SSC/0.5% SDS, 10 min at room temperature, twice; 1x SSC/0.5% SDS, 15 min at 65°C, twice; 0.7 SSC/0.1 SDS, 15 min at 65°C; 0.1 SSC, 5 min; (B) high-stringency: 2x SSC/0.5% SDS, 10 min at room temperature, twice; 1x SSC/0.1% SDS, 2% (w/v) sodium pyrophosphate, 15 min at 65°C, twice; 0.1 SSC/0.1 SDS, 15 min at 65°C; 0.1 SSC, 5 min. Results were visualized by exposure at -70°C to REFLECTION Film and Intensifying Screens (DuPont-NEN).
Probes for Specific mRNA.
To generate a bovine NKCC fragment for the nuclease protection assay, the Genbank cDNA sequences for rat, human, and rabbit were analyzed, and the two flanking segments for a 529-bp region of high homology were selected as primers. These primers correspond to rat NM_019134 sequence and were: sense, 1650 TTTCAGGTCATGAGCATGGTGTC 1672; and antisense, 2155 CCCCGAGGAGGTGTGTCCGAGAC 2177.
PCR was done using total bovine DNA as template and the primers above. The reaction generated a 529-bp fragment, which was extracted from agarose slices (QIAEXII Agarose Gel Extraction Kit, Qiagen, Chatsworth, CA). Fragments for bovine AQP1 and rat GLUT1 were in plasmids with a 372-bp insert of AQP1 (13) and a full-length rat cDNA insert of GLUT1 (both in pBS Bluescript® II).
32P-labeled, single-stranded DNA probes having a specific activity of 2 to 4 x 109 cpm/µg DNA for AQP1, GLUT1, and NKCC1 were generated by asymmetric PCR utilizing SK/KS-specific sense/antisense primers on the corresponding homologous DNA fragments referred to above. Unreacted nucleotides were removed by spin chromatography through Sephadex G-50. The probes were purified by 1% agarose gel electrophoresis. After identification of radioactive band locations by autoradiography, probes were extracted from agarose slices.
Nuclease Protection Assay.
Twenty microliters of cell lysate containing 150,000 cells was mixed with 5 µl of probe contained in 2x SSC/0.1 M EDTA and was incubated at 30°C for 20 hr. After hybridization, 2.5 µl of 10 mg/ml proteinase-K (Sigma) and 2.5 µl of 10% SDS were added. The mixture was incubated at 37°C for 30 min. Nucleic acids were extracted with one volume of a 1:1 mixture of buffer-saturated phenol:chloroform and isolated by spin chromatography through Sephadex G-50. An equivalent volume of S1 nuclease buffer was added, and the mixture was incubated at 45°C for 30 min. After digestion, samples and a 100-bp DNA ladder 32P-labeled with 5` DNA terminus labeling kit (BRL, Gaithersburg, MD) were electrophoresed in a 2% agarose gel at 100 V for
3 hr (4°C). The gels were dried and the positions of the RNA-DNA duplexes were determined by autoradiography as described above. The radioactivity of given bands associated with full-length RNA-DNA duplexes were quantified with scintillation counting. The number of mRNA molecules per cell was calculated with the following formula (14):
![]() | (1) |
Cpm hybridized obtained from scintillation counting were corrected for assay noise (cpm hybridized in the absence of target). Probe cpm/g was calculated from the manufacturer's 32P-
-dATP specification and was approximately 1015 cpm/g. Probe length was the number of nucleotides of full-length probe complementary to target.
Western Blot Analysis.
The initial steps for this analysis were performed at 4°C. Bovine or rabbit corneal layers or their cultured counterparts were washed twice with PBS and were then scraped with a steel blade in 0.5 ml of HB containing: 50 mM ß-glycerophosphate (pH 7.3), 1.5 mM EGTA, 1 mM EDTA, 0.1 mM Na-vanadate, 1 mM phenylmethylsulfonyl fluoride, 10 µg/ml leupeptin, 1 mM benzamidine, and 10 µg/ml aprotinin. Using a 1-ml syringe, the suspension was passed through a 26-gauge one-half-inch long needle until easy flow was achieved (three to eight times). Otherwise, all procedures were the same as those described by Bildin et al. (15) and a 1:10,000 dilution was used of T4 monoclonal antibody (DSHB, Iowa City, IA) to evaluate NKCC protein content.
Data Analysis.
All experimental data are expressed as mean ±SEM. Statistical significance was determined with the Student's t test (P < 0.05).
| Results |
|---|
|
|
|---|
Figure 2
shows the kinetics of lysis of fresh bovine corneal endothelial and epithelial layers in 5 M GuSCN/0.1 M EDTA solution. The total amount of protein that can be solubilized in each layer reached a plateau after 30 sec for the endothelial layer and after
2 min for the epithelial layer (not shown). The maximal levels of solubilized epithelial and endothelial protein (micrograms per microliter of lysate solution) reached 3.30 ± 0.17 and 0.69 ± 0.01, respectively (Fig. 2
). That the epithelial protein mass was about 5-fold greater than that of the endothelial counterpart is consistent with the fact that the corneal epithelium has 5-fold more cellular layers than the endothelium. As a control procedure, after solubilizing a given layer and aspirating the mixture, a new 200-µl aliquot of solubilizing solution (GuSCN/EDTA) was placed on the denuded stroma and left to stand for 2 to 3 min. This yielded only a negligible amount of protein. Hence, solubilization of stromal proteins must have been much slower than that for the cell layers, and did not play a part in our results. Based on these results, we chose a 2-min interval for the lysis of both corneal layers.
|
|
7.0 to 7.5 and 5.0 to 5.5 kb. In contrast, the data in Figure 3C
Nuclease Protection Assay of AQP1, GLUT1, and NKCC Expression.
Northern blotting is, of course, useful in analyzing the presence and size of mRNA, but it is limited in its ability to quantify messenger levels. To determine more precisely the levels of specific mRNAs, we performed lysate nuclease protection assays. Figure 4
, A through C, shows the results of representative S1-nuclease protection assay experiments. In all three panels, labeled bands appear in lanes 3 through 5 that represent the RNA/DNA protected duplexes. As shown on the histogram below (Fig. 4D
), the level of NKCC mRNA in bovine epithelium is low (5.0 ± 0.1) molecules/cell. Even lower values (
1 molecule/cell) are found in fresh and CBCEn cells, with cultures (third passage) having almost 2-fold lower NKCC mRNA levels. These corneal layers express sizably more (1012 times) AQP1 and GLUT1 mRNA (Fig. 4D
). However, their comparative patterns of expression are qualitatively similar to those seen for NKCC (fresh epithelium > fresh endothelium > CBCEn cells).
|
|
| Discussion |
|---|
|
|
|---|
As has been reported, application of a concentrated GuSCN/EDTA solution provides a convenient and rapid method for lysis and extraction of nuclear contents (17). Our use of this procedure appears to be effective because the results shown in Figure 2
reveal that the epithelial protein content is about 5-fold greater than that of the endothelium. This difference corresponds to the histological observation that the epithelium has five cellular layers, whereas the endothelium is a monolayer.
We obtained some suggestive evidence that in both epithelial and endothelial layers there is expression of two different NKCC isoforms. The results shown in Figure 3
, B and C, indicate that the probe to NKCC could hybridize with two different transcripts of 7.0 to 7.5 and 5.0 to 5.5 kb that are expressed in corneal tissues and cultured cells. The larger one is similar in size to the gene-specific transcript identified in a number of organs that encodes for the secretory NKCC isoform, NKCC1 (2,18). On the other hand, the smaller sized transcript is more similar in size to the NKCC2 (absorptive) isoform found in the medullary regions of the kidney of many species (18,19). Another suggestion for two isoforms is that high-stringency washing eliminated the shorter band (Fig. 3C
). This could have occurred because under high stringency conditions, the NKCC1 probe that hybridized with putative NKCC2 transcript can be more readily removed. Its dissociation is favored because, as mentioned above, the homology between NKCC1 and NKCC2 is estimated to be in the range between 55% and 65% (20). Western blotting with the anti-T4 antibody identified two protein bands with an apparent molecular mass of about 195 and 155 kDa in both bovine and rabbit corneal tissues and cultured cells (Fig. 5
, A and B). The apparent molecular mass of NKCC1 varies from 175 to 205 kDa in different species and tissues, whereas with NKCC2 it is about 150 kDa (2,18,19). These results also suggest that both the NKCC1 and NKCC2 isoforms may be expressed in both cornea layers. On the other hand, affinity-purified polyclonal anti-NKCC1 antibody identified proteins of 145 to 155 kDa in rat brain (21). This observation, together with the fact that in embryogenesis the eye develops from the brain, further suggest that in our study the smaller protein could also be a variant of NKCC1. Such a possibility could also account for a finding in mouse kidney where several alternatively spliced cDNAs encoding mNKCC2 were identified. Furthermore, selective antibodies detected proteins of approximately 150 and 120 kDa, respectively (22). Taken together, these results suggest that two different NKCC isoforms may be expressed in both corneal limiting layers. However, other explanations cannot be excluded, such as the existence of other transport proteins with adequate homology to NKCC at the RNA and amino acid levels. Sequencing will distinguish whether other transport proteins are being detected, or whether there are two specific gene transcripts expressing NKCC isoforms in both corneal tissues.
To examine the relative amounts of mRNAs encoding for NKCC, GLUT1, and AQP1 in corneal epithelium and endothelium and CBCEn cells, we used a S1 nuclease protection assay that we have independently developed. This method utilizes asymmetric PCR-generated 32P probes labeled to a high specific activity. This has the advantage of enabling the analysis of very small quantities of RNA. It increases the level of sensitivity by up to 100 times over that of Northern blot analysis. Furthermore, hybridization occurs in guanidine thiocyanate cell lysates, obviating the need for membrane transfer from gels.
The level of NKCC mRNA was five times higher in bovine epithelium than in endothelium (Fig. 4D
). However, the epithelial NKCC protein level was only 2.5-fold higher than that in the endothelium (Fig. 5B
). This dissociation may be due to differences in mRNA translation rate, stability, and/or variations in NKCC protein distribution between the plasma membrane and cytosol.
Our finding that there is AQP1 gene expression in the bovine cornea is in agreement with a previous study that used PCR to demonstrate that there is high level of expression of this isoform in the rat cornea (11). However, its origin is open to question because their preparation contained a mixture of the epithelium, stroma, and endothelium. In another study employing various immunodetection techniques on the rat corneal epithelium, no AQP1 protein expression was found (12). This discrepancy with our finding of AQP1 mRNA expression in the bovine cornea epithelium could mean that this message is not translated in normal conditions or reflects species variation.
After the third passage of epithelial and endothelial cells, AQP1, NKCC1, and GLUT1 mRNAs levels and NKCC protein expression fell 2- to 3-fold (Figs. 4 and 5![]()
). These observations are in agreement with other data that AQP1 is downregulated in vascular smooth muscle cells after several passages (23), and in cultured human insulinoma cells, there is GLUT gene expression in the early passages, but it is not seen at later passages (24). However, during differentiation of a human intestinal cell line, up to 3-fold increases in NKCC mRNA levels were accompanied by 7-fold increases in NKCC protein expression and approximately 2.5-fold increases in co-transporter functional activity (25).
In summary, our results suggest expression of both NKCC1 and NKCC2 isoforms in freshly isolated and cultured corneal epithelial and endothelial cells; and passage-dependent decreases occurred in mRNA that encode for the membrane transport proteins, NKCC, GLUT1, and AQP1 in cultured versus fresh endothelial cells. These declines suggest that studies with cultured cells may not always yield transport parameters similar to those in their parent tissue. In addition, an approach is described to measure specific mRNA abundance in small amounts of corneal tissue that may make it possible to avoid the use of cell culture to characterize gene expression.
| Footnotes |
|---|
1 To whom requests for reprints should be addressed at Department of Biological Sciences, College of Optometry, State University of New York, 33 West 42nd Street, New York, NY 10036. E-mail: vbildin{at}sunyopt.edu ![]()
| References |
|---|
|
|
|---|
This article has been cited by other articles:
![]() |
S. L. Sandow and T. H. Grayson Limits of isolation and culture: intact vascular endothelium and BKCa Am J Physiol Heart Circ Physiol, July 1, 2009; 297(1): H1 - H7. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. C. Kenney, S. R. Atilano, N. Zorapapel, B. Holguin, R. N. Gaster, and A. V. Ljubimov Altered Expression of Aquaporins in Bullous Keratopathy and Fuchs' Dystrophy Corneas J. Histochem. Cytochem., October 1, 2004; 52(10): 1341 - 1350. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |