Experimental Biology and Medicine 227:36-44 (2002)
© 2002 Society for Experimental Biology and Medicine
ORIGINAL ARTICLE
Differential Mechanisms of Ca2+ Release from Vascular Smooth Muscle Cell Microsomes
Ahad N.K. Yusufi,
Jingfei Cheng,
Michael A. Thompson,
John C. Burnett and
Joseph P. Grande,1
Renal Pathophysiology Laboratory, Department of Laboratory Medicine and Pathology, Mayo Clinic, Mayo Medical School, Rochester, Minnesota 55905
 |
Abstract
|
|---|
The release of Ca2+ from intracellular stores is a fundamental element of signaling pathways involved in regulation of vascular tone, proliferation, apoptosis, and gene expression. Studies of sea urchin eggs have led to the identification of three functionally distinct Ca2+ signaling pathways triggered by IP3, cADPR, and NAADP. The coexistence and functional relevance of these distinct intracellular Ca2+ release systems has only been described in a few mammalian cell types. The purpose of this study was to determine whether the IP3, cADPR, and NAADP Ca2+ release systems coexist in smooth muscle cells (SMC) and to determine the specificity of these intracellular Ca2+ release pathways. Microsomes were prepared from rat aortic SMC (VSMC) and were loaded with 45Ca2+. cADPR, NAADP, and IP3 induced Ca2+ release from VSMC microsomes in a dose-dependent fashion. Heparin blocked only IP3-mediated Ca2+ release, whereas the ryanodine channel inhibitors 8-Br-cADPR and ruthenium red blocked only cADPR-induced Ca2+ release. Nifedipine, an L-type Ca2+ channel blocker, inhibited NAADP elicited Ca2+ release, but had no effect on IP3- or cADPR-mediated Ca2+ release. An increase in pH from 7.2 to 8.2 inhibited cADPR-mediated Ca2+ release, but had no effect on IP3- or NAADP-induced Ca2+ release. By RT-PCR, VSMC expressed ryanodine receptor types 1, 2, and 3. Ca2+-dependent binding of [3H]-ryanodine to VSMC microsomes was enhanced by the ryanodine receptor agonists 4-chloro-methyl-phenol (CMP) and caffeine, but was inhibited by ruthenium red and cADPR. We conclude that VSMC possess at least three functionally distinct pathways that promote intracellular Ca2+ release. IP3-, cADPR-, and NAADP-induced intracellular Ca2+ release may play a critical role in the maladaptive responses of VSMC to environmental stimuli that are characteristically associated with hypertension and/or atherogenesis.
Key Words: vascular smooth muscle inositol-1,4,5-trisphosphate (IP3) cyclic ADP-ribose (cADPR) nicotinic acid-adenine dinucleotide phosphate (NAADP) calcium (Ca++)
 |
Introduction
|
|---|
The release of Ca2+ from intracellular stores and endoplasmic and sarcoplasmic reticulum (ER/SR) is one of the key signal transduction mechanisms in the regulation of numerous cellular functions (13), including contractility, protein synthesis and turnover, hormone secretion, proliferation, and activation. Currently, at least three distinct intracellular Ca2+-mobilizing systems have been identified. The most comprehensively studied is the Ca2+ release triggered by inositol-1,4,5-trisphosphate (IP3), an agonist that binds to a specific IP3-receptor/Ca2+ channel (46). A second major Ca2+ signaling pathway is triggered by cyclic ADP-ribose (cADPR), an adenine nucleotide synthesized from ß-NAD by the enzyme ADP-ribosyl cyclase (79). cADPR induces Ca2+ release via the ryanodine receptor/channel (RyR) by increasing the sensitivity of RyR for Ca2+, thereby causing Ca2+ release by a Ca2+-induced Ca2+ release mechanism (CICR) (9, 10). Ryanodine receptors have been described in vascular and cardiac muscle cells and in several nonexcitable cell types (11). We have recently demonstrated that rat mesangial cells, contractile cells with smooth muscle-like properties, possess elements of a cADPR
RyR
Ca2+ signaling pathway (12).
A third intracellular Ca2+ signaling pathway, activated by nicotinic acid-adenine dinucleotide phosphate (NAADP), has recently been identified through studies of Ca2+ release in sea urchin eggs (7, 9, 10, 13). NAADP, an analog of ß-NADP, controls intracellular Ca2+ release by a mechanism fundamentally different from that of IP3 or cADPR (13). We have recently shown that NAADP elicits specific Ca2+ release from microsomes prepared from a variety of cells and cell lines, suggesting that the capacity for NAADP-induced Ca2+ release is widespread in mammalian cells (14).
The physiologic relevance of intracellular Ca2+ signaling pathways triggered by IP3, cADPR, and NAADP has not been adequately defined. The IP3
IP3R
Ca2+ release system is ubiquitously distributed (5, 15); this pathway mediates rapid intracellular Ca2+ release in response to vasoactive mediators such as endothelin or vasopressin (2, 6). In addition to promoting Ca2+-induced Ca2+ release (9), the cADPR
RyR
Ca2+ release pathway is involved in insulin release by pancreatic ß cells (16) and gonadotrophin releasing hormone, signaling (17). Recent studies have shown that the activity of ADP-ribosyl cyclase, the enzyme responsible for cADPR synthesis, is upregulated in various tissues and cell types by steroid superfamily hormones such as retinoic acid (18), ß-estradiol (19), or 3,5,3`-triiodothyronine (20). Although little is known about NAADP-elicited intracellular Ca2+ release in mammalian cells, we have recently demonstrated that retinoic acid increases capacity for NAADP biosynthesis in rat mesangial cells (21). The IP3, cADPR, and NAADP signaling systems coexist in ascidian oocytes, and each system mediates distinct changes associated with fertilization and early development of the oocyte (22).
The IP3, cADPR, and NAADP intracellular Ca2+ signaling pathways have not previously been directly compared in mammalian cells. Since alterations in intracellular Ca2+ have been shown to play a major role in vascular smooth muscle contractility, hypertrophy, and hyperplasia (23), these functionally distinct intracellular Ca2+ signaling pathways may direct adaptive cellular responses to pathobiologic stimuli. Here, we report that primary cultures of rat aortic smooth muscle cells (SMCs) possess functionally distinct Ca2+ signaling pathways triggered by IP3, cADPR, and NAADP. IP3 augments ryanodine binding to smooth muscle microsomes, indicating a potential site of crosstalk between the IP3 and cADPR signaling pathways.
 |
Materials and Methods
|
|---|
[3H]-ryanodine and 45Ca2+ were purchased from Amersham Pharmacia Biotech (Piscataway, NJ). cADPR, 8-bromo-cyclic ADP ribose (8-Br-cADPR), ADPR, and ruthenium red (RR) were purchased from Calbiochem (La Jolla, CA). 4-Cl-methyl-phenol (CMP) was from Aldrich (Milwaukee, WI). Nicotinamide guanine dinucleotide (NGD), cyclic GDP-ribose (cGDPR), caffeine, and calmodulin were obtained from Sigma (St. Louis, MO). All other chemicals and biochemicals, all of highest purity grades, were from other standard suppliers.
Vascular SMC (VSMC) Isolation and Culture.
VSMC were isolated and subcultured from rat aorta explant outgrowths as previously described (24). Briefly, the aorta was isolated from 200- to 250-g male Sprague-Dawley rats, cleaned in ice-cold sterile 0.9% NaCl, endothelium was removed by scraping, and adventitia was removed with surgical tweezers. The tissue was then minced and placed in 100-mm petri dishes with Dulbecco's modified Eagle's medium (DMEM) supplemented with 10% fetal bovine serum, 100 U/ml penicillin, 100 µg/ml streptomycin, and 2.5 µg/ml amphotericin B. VSMC outgrowths were characterized by positive immunocytochemical staining against
-smooth muscle actin and phase-contrast microscopy as previously described (24, 25). Cell cultures were maintained at 37°C in an atmosphere of 95% air and 5% CO2. After reaching confluence on 100 mm-diameter dishes, cells were washed twice with phosphate-buffered saline (PBS) and they were incubated in serum-free DMEM. Cells were used between passages 4 and 12.
Isolation of Microsomes.
Microsomal fractions were prepared from harvested cultured rat VSMC as previously described (21, 26). In brief, harvested cells were chilled to 4°C and were suspended in a buffer containing 300 mM sucrose, 10 mM HEPES, 0.1 mM EDTA, and 0.5 mM PMSF (pH 7.4) and homogenized by polytron (3 x 30 sec at setting 10). The homogenate was centrifuged for 10 min at 1600g, and the pellet was discarded. The supernatant was further centrifuged at 11,000g for 20 min, and the supernatant thus obtained was ultracentrifuged at 100,000g for 1 hr. The pellet was resuspended in a small volume of homogenizing buffer using a Dounce homogenizer. The microsomes were then either used fresh for measurement of 45Ca2+ release, or were divided into aliquots, quickly frozen, and stored at -80°C for measurement of [3H]-ryanodine binding (12). Storage at -80°C preserved the [3H]-ryanodine binding capacity of microsomes. The protein content of fractions was determined by the method of Lowry et al. (27).
PCR Analysis.
Total RNA was isolated from VSMC using the RNeasy Total RNA Isolation kit (Qiagen, Valencia, CA) according to the manufacturer's protocol. Reverse transcription and PCR amplification were performed using the GeneAmp System (Perkin Elmer, Branchburg, NJ). PCR analysis of RyR-1, RyR-2, and RyR-3 was performed essentially as previously described (28). Design of PCR primers was based upon GenBank accession numbers X83932 (RyR-1), X83933 (RyR-2), and X83934 (RyR-3) (28). The nucleotide sequence and length of expected PCR products for each primer pair are: RyR-1 (s), GAAGGTTCTGGACAAACACGGG; RyR-1 (as), TCGCTCTTGTTGTAGAATTTGCGG (435 bp); RyR-2 (s), GAATCAGTGAGTTACTGGGCATGG; RyR-2 (as), CTGGTCTCTGAGTTCTCCAAAAGC (635 bp); RyR-3 (s), AGAAGAGGCCAAAGCAGAGG; RyR-3 (as), GGAGGCCAACGGTCAGA (269 bp). All PCR products were was sequenced in both orientations. To exclude the possibility that genomic DNA rather than cDNA was amplified, control reactions were performed in which the reverse transcription step was omitted prior to PCR amplification. Additional negative control reactions were performed in which the template was omitted.
[3H]-Ryanodine Binding.
This was carried out as previously described (12, 29, 30). Microsomes (100200 µg of protein) were incubated for 2 hr at 37°C in a medium containing (final concentration) 600 mM KCl, 100 µM EGTA, 150 µM Ca2+, 0.2 mM PMSF, 25 mM HEPES (pH 7.2), and 30 nM [3H]-ryanodine (54.7 Ci/mm). Free [3H]-ryanodine was separated from [3H]-ryanodine bound to microsomes by a rapid filtration technique using Whatman GF/B filters, followed by three subsequent washes with ice-cold water. The [3H]-ryanodine radioactivity that remained on the filters was measured by liquid scintillation counting. The high-affinity Ca2+-dependent specific [3H]-ryanodine binding was calculated as the difference of total binding and nonspecific binding, determined in the presence of RR (10 µM).
45Ca2+ Release from Microsomes.
Freshly prepared microsomes (approximately 100 µg of protein) were passively loaded by incubating for 3 hr at room temperature (21°C) in a medium containing 100 mM NaCl, 25 mM HEPES (pH 7.2), 1 mM CaCl2, and 1 µCi of 45Ca2+. Release of 45Ca2+ from loaded microsomes was initiated by 10-fold dilution of microsomal suspension with a buffer containing 100 mM NaCl, 1 mM EGTA, 1 mM MgCl2, and 25 mM HEPES (pH 7.2), as previously described (26). After 10 sec, the suspension was further diluted in a medium of identical composition that contained agonists or antagonists to be tested. 45Ca2+ efflux was stopped at 90 sec after the second dilution with added test agents. 45Ca2+ retained in microsomes was separated from free 45Ca2+ by rapid filtration using Whatman GF/B filters. The filters were rinsed three times with a solution containing 100 mM NaCl, 1 mM EGTA, 4 mM MgCl2, 10 µM ruthenium red, and 25 mM HEPES (pH 7.2). The 45Ca2+ retained in microsomes was determined by liquid scintillation counting.
Synthesis of NAADP.
The NAADP synthetic capacity was assessed as previously described (21). In brief, membrane fraction of homogenized cells (0.3 mg/ml) was incubated with 0.2 mM ß-NADP and 7 mM nicotinic acid at 37°C in a medium containing 0.25 M sucrose and 20 mM Tris HCl (pH 6.5) for 60 min. The content of NAADP was determined using a sea urchin egg homogenate Ca2+ release bioassay (21, 31).
Sea Urchin Egg Homogenate Bioassay.
Homogenates from sea urchin eggs (Lytechinus pictus) were prepared as described previously (21, 31). Frozen homogenates were thawed in a 17°C water bath and diluted to 1.25% in a medium containing 2 U/ml creatine kinase, 4 mM phosphocreatine, 1 mM ATP, and 3 µM fluo-3. Fluo-3 fluorescence was monitored at 490 nm excitation and 535 nm emission in a 250-µl cuvette at 17°C with a circulating water bath and continuously mixed with a magnetic stirring bar using a Hitachi F-2000 spectrofluorimeter (Hitachi, Tokyo, Japan).
Statistical Analysis.
Data presented are representative of at least three independent experiments performed in triplicate, as indicated in figure legends. Statistical analysis was performed using InStat (GraphPad, San Diego, CA). Group or pairwise comparisons were evaluated by the Students t test; P values of <0.05 were considered statistically significant.
 |
Results
|
|---|
Dose-Dependent Ca2+ Release.
IP3, cADPR, and NAADP induced Ca2+ release from VSMC microsomes, indicating that VSMC possess elements of all three intracellular Ca2+ signaling pathways. Microsomal Ca2+ release by the agonists is dose-dependent. Maximal Ca2+ release by 10 µM cADPR and 10 µM NAADP was similar to that elicited by 8 µM IP3 (Fig. 1
).
Effect of Specific Ca2+ Release Antagonists.
We further characterized specificity of microsomal Ca2+ release by IP3, cADPR, and NAADP. Heparin (1 mg/ml), a specific IP3 receptor blocker, abolished IP3-elicited microsomal Ca2+ release. However, RR, an inhibitor of the ryanodine channel/receptor (RyR), failed to block IP3-mediated microsomal Ca2+ release (Fig. 2A
). cADPR-elicited microsomal Ca2+ release was completely blocked by co-administration of cADPR either with 8-bromo-cADPR (an antagonist of cADPR) (32) or with RR (a ryanodine channel blocker; Fig. 2B
). Heparin, an IP3 receptor blocker, had no effect on cADPR-elicited Ca2+ release (data not shown). NAADP-triggered Ca2+ release was not inhibited by heparin or by RR (Fig. 2C
). ß-NADP, a biosynthetic precursor of NAADP, failed to induce Ca2+ release from VSMC microsomes (Fig. 2C
). Pretreatment of NAADP with alkaline phosphatase (25 U/mL) at 35°C for 10 min abolished its Ca2+ releasing activity (data not shown). These studies provide evidence that Ca2+ release from VSMC is specific for NAADP and not its biosynthetic precursor (ß-NADP) or its degradation product (NAAD). Nifedipine, an L-type Ca2+ channel blocker, completely abolished NAADP-elicited Ca2+ release (Fig. 3
). Nifedipine had no effect on IP3- or cADPR-mediated Ca2+ release (Fig. 3
).

View larger version (22K):
[in this window]
[in a new window]
|
Figure 2. Effects of various calcium mobilizing agents and their antagonists on Ca2+ release from VSMC microsomes. (A) Specific Ca2+ release from VSMC microsomes by IP3. Values are mean ± SEM (n = 3). *, Significantly different from control values (t test, P < 0.05). Open bar, control (no addition); closed bar, 8 µM IP3; hatched bar, 8 µM IP3 + 1 mg/ml heparin; double-hatched bar, 8 µM IP3 + 10 µM ruthenium red. (B) Specific Ca2+ release from VSMC microsomes by cADPR. Values are mean ± SEM (n = 3). * = significantly different from control values (t test, P < 0.05); open bar, control (no addition); closed bar, 10 µM cADPR; hatched bar, 10 µM cADPR + 40 µM 8-Br-cADPR; double-hatched bar, 10 µM cADPR + 10 µM ruthenium red. (C) Specific Ca2+ release from VSMC microsomes by NAADP. Values are mean ± SEM (n = 3). * = significantly different from control values (t test, P < 0.05). Open bar, control (no addition); closed bar, 10 µM NAADP; first hatched bar, 10 µM NAADP + 1 mg/ml heparin; second hatched bar, 10 µM NAADP + 10 µM ruthenium red; double-hatched bar, 10 µM ß-NADP.
|
|

View larger version (38K):
[in this window]
[in a new window]
|
Figure 3. The effect of nifedipine, an L-type Ca2+ channel blocker, on 45Ca2+ release from microsomes treated with NAADP, IP3, or cADPR. Open bar, control; closed bar, 10 µM NAADP; gray bar, 10 µM NAADP + 100 µM nifedipine; first white hatched bar, 8 µM IP3; first hatched gray bar, 8 µM IP3 + 100 µM nifedipine; second white hatched bar, 10 µM cADPR; second hatched gray bar, 10 µM cADPR + 100 µM nifedipine. Values are mean ± SEM (n = 3). *, Significantly different from control values (t test, P < 0.05). **, Significantly different from both control and NAADP-treated values (P < 0.01).
|
|
Effect of pH on Ca2+ Release by IP3, cADPR, and NAADP.
In agreement with our previous findings in sea urchin eggs and our observations in cultured rat mesangial cells (14, 33), IP3- or NAADP-induced Ca2+ release was not affected by changing the pH of the incubation buffer from 7.2 to 8.2 (Fig. 4
). In contrast, the cADPR-induced Ca2+ release was inhibited by alkalinization of media (Fig. 4
).

View larger version (14K):
[in this window]
[in a new window]
|
Figure 4. Effect of pH on Ca2+ release elicited by IP3, cADPR, and NAADP from VSMC microsomes. Ca2+ release from microsomes treated with 8 µM IP3, 10 µM cADPR, or 10 µM NAADP was assessed as described in the ``Materials and Methods.'' Data represent specific Ca2+ release by agonist minus Ca2+ release in controls, which was 121 ± 10 pmol/90 sec per mg of protein. Values are mean ± SEM. *, Values significantly different from values observed at pH 7.2 for three separate experiments.
|
|
Presence of Functional RyR in VSMC Microsomes.
Previous studies have shown that intracellular Ca2+ release by cADPR is mediated by the RyR. We next sought to determine which isoforms of RyR are present in primary VSMC cultures and their role in microsomal Ca2+ release. RT-PCR studies revealed the presence of type 1 (RyR-1), type 2 (RyR-2), and type 3 (RyR-3) ryanodine receptors (Fig. 5
). Sequence analysis of the PCR products revealed essentially 100% homology to the previously reported rat RyR-1, RyR-2, and RyR-3 sequences (see ``Materials and Methods''). Negative control reactions in which the template was omitted or the reverse transcriptase step was not performed prior to PCR amplification failed to produce a product (Fig. 5
). Assessment of Ca2+-dependent, high-affinity [3H]-ryanodine binding is a well-established method for detection and quantification of RyRs (15, 29, 30). We observed that [3H]-ryanodine (30 nM) binds to VSMC microsomes with high affinity. [3H]-ryanodine binding was Ca2+-dependent and was blocked by 10 µM RR (Fig. 6A
). Ca2+ (50 µM) enhanced [3H]-ryanodine binding to VSMC microsomes by 76% compared with nonspecific binding in the absence of Ca2+ (Fig. 6A
). This Ca2+-dependent [3H]-ryanodine binding was completely blocked by 10 µM RR, an RyR blocker (Fig. 6A
). Further studies were undertaken to define the specificity of Ca2+-dependent [3H]-ryanodine binding (as defined by [3H]-ryanodine binding to VSMC microsomes in the presence of 50 µM Ca2+ that is inhibited by 10 µM RR). We measured the binding in the presence of caffeine and CMP, established agonists of RyR (26, 30, 34). Both caffeine and CMP significantly enhanced Ca2+-dependent specific [3H]-ryanodine binding (Fig. 6B
). Moreover, Ca2+-dependent binding was inhibited by calmodulin (CaM), a protein that interacts with the RyR and appears to be required for cADPR-elicited Ca2+ release (35).

View larger version (73K):
[in this window]
[in a new window]
|
Figure 5. NRyR expression by VSMC. cDNA fragments of RyR-1, RyR-2, and RyR-3 were amplified from VSMC cDNA, as described in ``Materials and Methods.'' VSMC express RyR-1 (435 bp), RyR-2 (635 bp), and RyR-3 (269 bp). refers to negative control reaction in which the reverse transcriptase step was omitted prior to PCR amplification.
|
|

View larger version (21K):
[in this window]
[in a new window]
|
Figure 6. [3H]-ryanodine binding to VSMC microsomes. (A) Specific [3H]-ryanodine binding. The microsomes were incubated with 30 nM [3H]-ryanodine (see "Materials and Methods'' for details) without adding Ca2+ (control, open bar); or in the presence of 50 µM Ca2+ without (hatched bar) or with (closed bar) 10 µM ruthenium red. Each bar denotes mean ± SEM, n = 3 experiments. * denotes value significantly different from control (t test, P < 0.05). (B) The effect of RyR agonists or antagonists upon specific Ca2+-dependent [3H]-ryanodine binding to VSMC microsomes. All binding studies were performed in the presence of 50 µM Ca2+. Open bar, control, no additions; closed bar, 20 mM caffeine; hatched bar, 0.5 mM 4-Cl-methyl-phenol (CMP); double-hatched bar, 5 µM calmodulin (CaM). * denotes values significantly different from control (t test, P < 0.05).
|
|
Effect of IP3, cADPR, and NAADP on Ca2+-dependent [3H]-Ryanodine Binding.
cADPR significantly inhibited Ca2+-dependent [3H]-ryanodine binding to VSMC microsomes (Fig. 7
), whereas NAADP had no effect on [3H]-ryanodine binding. IP3 significantly augmented Ca2+-dependent [3H]-ryanodine binding to VSMC microsomes (Fig. 7
).

View larger version (23K):
[in this window]
[in a new window]
|
Figure 7. Effects of 10 µM cADPR, 10 µM NAADP, and 8 µM IP3 on calcium-dependent [3H]-ryanodine binding to VSMC microsomes. All binding studies were performed in the presence of 50 µM Ca2+. Each bar denotes mean ± SEM, n = 3 experiments. * values are significantly different (t test, P < 0.05) from controls.
|
|
The functional relevance of RyR in VSMC was determined by examining the release of Ca2+ from passively preloaded microsomes with 45Ca2+. Both caffeine and CMP significantly enhanced Ca2+ release from VSMC microsomes (Fig. 8
). The increment of Ca2+ release as well as enhanced [3H]-ryanodine binding in response to both caffeine and CMP were all blocked by RR (Fig. 8
).

View larger version (16K):
[in this window]
[in a new window]
|
Figure 8. Microsomal Ca2+ release from VSMC by RyR agonists. Open bar, control; 20 mM caffeine without (first closed bar) or with (first hatched bar) 10 µM RR and 0.5 M 4-Cl-methyl-phenol (CMP) without (second closed bar) or with (second hacted bar) 10 µM ruthenium red. Each bar denotes mean ± SEM, n = 3 experiments. * values are significantly different (t test, P < 0.05) from controls.
|
|
Synthesis of cADPR and NAADP by VSMC.
Recently, we reported the ability of VSMC to synthesize cADPR by ADPR cyclase (20). However, the capacity for NAADP synthesis in primary VSMC cultures has not yet been documented. Membrane fractions of VSMC were incubated with ß-NADP and nicotinic acid as described in ``Materials and Methods'' (21), and NAADP content was assessed by the sea urchin egg homogenate Ca2+ release bioassay (36). VSMC have a high capacity for NAADP synthesis, similar to that of rat mesangial cells, which are contractile cells with smooth muscle-like properties (37, 38) (Fig. 9
).

View larger version (10K):
[in this window]
[in a new window]
|
Figure 9. Biosynthesis of nicotinic acid adenine dinucleotide phosphate (NAADP) by rat mesangial cells (open bar) and VSMC (closed bar) using sea urchin egg homogenate bioassay as described in ``Materials and Methods.''
|
|
 |
Discussion
|
|---|
Intracellular Ca2+ release is fundamental to many responses to environmental stimuli, including contractility, proliferation, apoptosis, and gene expression (39, 40). Studies of sea urchin eggs (7, 9, 10) and ascidian eggs (22) have led to the identification of three functionally distinct intracellular Ca2+ signaling pathways. Of the three, the IP3-dependent mechanism has a ubiquitous distribution (41). In general, the IP3 signaling system is involved in transduction of signals elicited by fast-onset, short-acting agents such as vasoactive peptides (2, 41). Since the initial description of the cADPR signaling pathway in sea urchin eggs (7, 42), more recent studies have shown that a variety of both contractile and noncontractile cells possess this signaling pathway (9, 11, 43). cADPR sensitizes RyR to Ca2+ and activates CICR (9, 10). cADPR production is increased by a variety of pro-inflammatory cytokines and hormones, including retinoic acid and triiodothyronine (12, 20). Unlike the IP3 and cADPR Ca2+ release systems, much less is known about regulation of NAADP-elicited Ca2+ release in mammalian cells. It has been shown that NAADP-sensitive Ca2+ stores can be physically separated from intracellular Ca2+ stores sensitive to IP3 and cADPR (9, 44). We have recently demonstrated that the capacity for NAADP-induced Ca2+ release may be widespread in mammalian cells (14). Cells possess many discrete intracellular Ca2+ stores (45, 46), which may be differentially regulated by these functionally distinct intracellular Ca2+ signaling pathways. However, the coexistence of all three signaling pathways has only been described in a few cell types, including sea urchin eggs, mouse pancreatic acinar cells, and human Jurkat T lymphocytes (46). The primary aim of this study was to directly compare these Ca2+ signaling pathways in primary cultures of VSMC.
We found that IP3, cADPR, and NAADP elicited Ca2+ release in a dose-dependent fashion from VSMC microsomes, providing evidence that all three Ca2+ signaling pathways are present in cultured VSMC (Fig. 1
). Specificity of Ca2+ release triggered by the IP3, cADPR, and NAADP pathways was verified using specific agonists and antagonists (Figs. 2 and 3
). It has been previously reported that Ca2+ release through intracellular Ca2+ channels can be regulated by pH (47). Ca2+ release from VSMC microsomes was differentially affected by IP3, cADPR and NAADP at pH 7.2 and 8.2 (Fig. 4
), providing further evidence that these Ca2+ agonists signal through functionally distinct pathways. Alkalinization of the media may alter the binding of cADPR to its receptor or may affect activation of RyRs by pharmacological agonists (48).
Previous studies in other cell systems have provided evidence that IP3 and cADPR promote intracellular Ca2+ release through activation of different receptor complexes; the receptor involved in NAADP-elicited intracellular Ca2+ release has not yet been characterized. In VSMC, IP3R-1 is the predominant intracellular Ca2+ release channel activated through binding of IP3 (49, 50). Several lines of evidence support the presence of functionally competent ryanodine receptors in VSMC (51). RyR-3 and possibly RyR-1 receptors have been identified in VSMC (52). By RT-PCR we have identified the presence of functional RyR-1, RyR-2, and RyR-3 in VSMC (Fig. 5
). We found that [3H]-ryanodine specifically binds to VSMC microsomes in a Ca2+-dependent manner. Specificity of Ca2+-dependent [3H]-ryanodine binding was verified using established RyR agonists and antagonists.
We report here for the first time that [3H]-ryanodine binding to VSMC microsomes is significantly enhanced by IP3 (Fig. 7
). This observation provides evidence that the IP3 receptor complex can activate the ryanodine receptor/channel to facilitate Ca2+-induced Ca2+ release (CICR) by cADPR or other agonists of RyR. IP3 and cADPR may thereby complement each other in inducing Ca2+ release by CICR in VSMC microsomes.
We found that cADPR inhibits [3H]-ryanodine binding to VSMC microsomes (Fig. 7
). This observation would suggest that cADPR and ryanodine compete for binding to a similar site on the ryanodine receptor (10). However, in other cell systems, both stimulatory (5355) and inhibitory (56) effects of cADPR on [3H]-ryanodine binding have been described. Ca2+ release from VSMC microsomes was induced by RyR agonists (caffeine or CMP) and inhibited by RyR antagonists (RR), providing further evidence for the functional relevance of RyRs in VSMC. Unlike IP3 and cADPR, NAADP had no effect on [3H]-ryanodine binding (Fig. 7
), again confirming that Ca2+ signaling by NAADP is independent of IP3 and cADPR controlled Ca2+ signaling pathways. Previous studies have demonstrated that the enzyme ADP-ribosyl cyclase, which synthesizes cADPR from ß-NAD, also catalyzes the production of NAADP from ß-NADP (57, 58). Recent studies have shown that a variety of mammalian cells possess a capacity for NAADP biosynthesis, utilizing a reaction that requires high concentrations of ß-NADP and nicotinic acid (14). The physiologic relevance of this pathway, or the presence of other pathways responsible for NAADP biosynthesis in vivo, remain to be established. In addition, the intracellular receptor for NAADP has not yet been characterized. However, widespread distribution of binding sites for NAADP has recently been reported in brain tissues (59).
In summary, we have established the presence of functionally distinct intracellular Ca2+ signaling pathways triggered by IP3, cADPR, and NAADP in VSMC. Although the presence of all three intracellular Ca2+ signaling pathways has only been described in a few cell types (46), it is likely that future studies will document the coexistence of these pathways in a wide variety of both contractile and noncontractile cells. The functional relevance of intracellular Ca2+ release directed by IP3, cADPR, and NAADP remains to be established, and may depend in large part upon cell type. For example, the IP3 and cADPR pathways are functionally redundant during fertilization of sea urchin eggs (60, 61). In pancreatic acinar cells, the IP3, cADPR, and NAADP pathways interact to coordinate apical release of secretory granules (62). IP3R-1-deficient T cells are resistant to apoptosis in response to a variety of stimuli (39) and have defects at antigen-specific signaling (63), indicating that an intact IP3 system is essential for these processes.
Abnormalities in intracellular Ca2+ signaling have recently been described in a variety of cardiovascular diseases. For example, end-stage heart disease is associated with downregulation of RyR-2 and an upregulation of IP3R-1 (64). Angiotensin II-mediated hypertrophy of VSMC is dependent upon an increase in intracellular Ca2+ levels (23). The specific intracellular Ca2+ signaling pathway(s) responsible for this effect have yet to be elucidated. Future studies will define the role of IP3, cADPR, and NAADP in normal VSMC function and response to pathobiologic stimuli.
 |
Acknowledgments
|
|---|
The excellent secretarial assistance of Ms. Cherish Grabau is gratefully acknowledged.
 |
Footnotes
|
|---|
This work was supported by the National Institutes of Health (grants DK16105 and 55603).
1 To whom requests for reprints should be addressed at Mayo Foundation, 200 First Street SW, Rochester, MN 55905. E-mail: grande.joseph{at}mayo.edu 
 |
References
|
|---|
-
Hotchkiss R, Karl I. Calcium: a regulator of the inflammatory response in endotoxemia and sepsis. New Horizons 4:5871, 1996.[Medline]
-
Berridge M. The biology and medicine of calcium signaling. Mol Cell Endocrinol 98:119124, 1994.[Medline]
-
Clapham D. Calcium signaling. Cell 80:259268, 1995.[Medline]
-
Streb H, Irvine RF, Berridge MJ, Schulz I. Release of Ca2+ from a nonmitochondrial intracellular store in pancreatic acinar cells by inositol-1,4,5-trisphosphate. Nature 306:679, 1983.[Medline]
-
Berridge M. Inositol triphosphate and calcium signaling. Ann NY Acad Sci 766:3143, 1995.[Medline]
-
Berridge M. Elementary and global aspects of calcium signaling. J Physiol 499:291306, 1997.[Medline]
-
Lee H. Cyclic ADP-ribose: a calcium mobilizing metabolite of NAD (+). Mol Cell Biochem 138:229235, 1994.[Medline]
-
Galione A, White A. Ca2+ release induced by cyclic ADP-ribose. Trends Cell Biol 4:431436, 1994.[Medline]
-
Lee H. Mechanisms of calcium signaling by cyclic ADP-ribose and NAADP. Physiol Rev 77:11331164, 1997.[Abstract/Free Full Text]
-
Dousa T, Chini E, Beers K. Adenine nucleotide diphosphates: emerging second messengers acting via intracellular Ca release. Am J Physiol 271:C1007C1024, 1996.[Abstract/Free Full Text]
-
Bennett D, Cheek T, Berridge M, De Smedt H, Parys J, Missiaen L, Bootman M. Expression and function of ryanodine receptors in nonexcitable cells. J Biol Chem 271:63566362, 1996.[Abstract/Free Full Text]
-
Yusufi A, Cheng J, Thompson M, Dousa T, Warner G, Walker H, Grande J. cADP-ribose/ryanodine channel/Ca2+-release signal transduction pathway in mesangial cells. Am J Physiol 281:F92F102, 2001.
-
Lee H, Aarhus R. A derivative of NADP mobilizes Ca2+ stores insensitive to inositol triphosphate and cyclic ADP-ribose. J Biol Chem 270:21522157, 1995.[Abstract/Free Full Text]
-
Yusufi A, Cheng J, Thompson M, Chini E, Grande J. NAADP elicits specific microsomal Ca2+ release from mammalian cells. Biochem J 353:531536, 2001.[Medline]
-
Mackrill J, Challiss R, O'Connell D, Lai F, Nahorski S. Differential expression and regulation of ryanodine receptor and myo-inositol 1,4,5-triphosphate receptor Ca2+ release channels in mammalian tissues and cell lines. Biochem J 327:251258, 1997.
-
Takasawa S, Akiyama T, Nata K, Kuroki M, Tohgo A, Noguchi M, Kobayashi S, Kato I, Katada T, Okamoto H. Cyclic ADP-ribose and inositol 1,4,5-triphosphate as alternate second messengers for intracellular Ca2+ mobilization in normal and diabetic ß-cells. J Biol Chem 273:24972500, 1998.[Abstract/Free Full Text]
-
Sundaresan S, Weiss J, Bauer-Dantoin A, Jameson J. Expression of ryanodine receptors in the pituitary gland: evidence for a role in gonadotropin-releasing hormone signaling. Endocrinology 138:20562065, 1997.[Abstract/Free Full Text]
-
Beers K, Chini E, Dousa T. All-trans-retinoic acid stimulates synthesis of cyclic ADP-ribose in renal LLC-PK1 cells. J Clin Invest 95:23852390, 1995.
-
Chini E, de Toledo F, Thompson M, Dousa T. Effect of estrogen upon cyclic ADP ribose metabolism: ß-estradiol stimulates ADP ribosyl cyclase in rat uterus. Proc Natl Acad Sci U S A 94:58725876, 1997.[Abstract/Free Full Text]
-
de Toledo F, Cheng J, Dousa T. Retinoic acid and triidothyronine stimulate ADP-ribosyl cyclase activity in rat vascular smooth muscle cells. Biochem Biophys Res Commun 238:847850, 1995.
-
Cheng J, Yusufi AN, Thompson MA, Chini EN, Grande JP. Nicotinic acid adenine dinucleotide phosphate: a new Ca2+ releasing agent in kidney. J Am Soc Nephrol 12:5460, 2001.[Abstract/Free Full Text]
-
Albrieux M, Lee H, Villaz M. Calcium signaling by cyclic ADP-ribose, NAADP, and inositol triphosphate are involved in distinct functions in ascidian oocytes. J Biol Chem 273:1456614574, 1998.[Abstract/Free Full Text]
-
Berk BC, Vekshtein V, Gordon HM, Tsuda T. Angiotensin II-stimulated protein synthesis in cultured vascular smooth muscle cells. Hypertension 13:305314, 1989.[Abstract/Free Full Text]
-
Chini E, Klener P, Beers K, Chini C, Grande J, Dousa T. Cyclic ADP-ribose metabolism in rat kidney: high capacity for synthesis in glomeruli. Kidney Int 51:15001506, 1997.[Medline]
-
Chamley-Campbell J, Campbell GR, Ross R. The smooth muscle cell in culture. Physiol Rev 59:161, 1979.[Free Full Text]
-
Herrmann-Frank A, Richter M, Sarkozi S, Mohr U, Lehmann-Horn F. 4-Chloro-m-cresol, a potent and specific activator of the skeletal muscle ryanodine receptor. Biochim Biophys Acta 1289:3140, 1996.[Medline]
-
Lowry O, Rosebrough A, Farr A, Randall R. Protein measurement with folin phenol reagent. J Biol Chem 193:265275, 1951.[Free Full Text]
-
Coussin F, Macrez N, Morel JL, Mironneau J. Requirement of ryanodine receptor subtypes 1 and 2 for Ca2+-induced Ca2+ release in vascular myocytes. J Biol Chem 275:95969603, 2000.[Abstract/Free Full Text]
-
DiJulio D, Watson E, Pessah I, Jacobson K, Ott S, Buck E, Singh J. Ryanodine receptor type III (Ry3R) identification in mouse parotid acini. J Biol Chem 272:1568715696, 1997.[Abstract/Free Full Text]
-
Richter M, Schleithoff L, Deufel T, Lehmann-Horn F, Herrmann-Frank A. Functional characterization of a distinct ryanodine receptor mutation in human malignant hyperthermia-susceptible muscle. J Biol Chem 272:52565260, 1997.[Abstract/Free Full Text]
-
Chini E, Beers K, Chini C, Dousa T. Specific modulation of cyclic ADP-ribose-induced Ca2+ release by polyamines. Am J Physiol 269:C1042C1047, 1995.[Abstract/Free Full Text]
-
Walseth T, Lee H. Synthesis and characterization of antagonists of cyclic-ADP-ribose-induced Ca2+ release. Biochim Biophys Acta 1178:235242, 1993.[Medline]
-
Chini E, Liang M, Dousa T. Differential effect of pH upon cyclic-ADP-ribose and nicotinate-adenine dinucleotide phosphate-induced Ca2+ release systems. Biochem J (London) 335:499504, 1998.
-
Islam M, Leibiger I, Leibiger B, Rossi D, Sorrentino V, Ekstrom T, Westerblad H, Andrade F, Berggren P. In situ activation of the type 2 ryanodine receptor in pancreatic ß cells requires cAMP-dependent phosphorylation. Proc Natl Acad Sci U S A 95:61456150, 1998.[Abstract/Free Full Text]
-
Lee H. Modulator and messenger functions of cyclic ADP-ribose in calcium signaling. Recent Prog Horm Res 51:355389, 1996.
-
Aarhus R, Graeff R, Dickey D, Walseth T, Lee H. ADP-ribosyl cyclase and CD38 catalyze the synthesis of a calcium-mobilizing metabolite from NADP. J Biol Chem 270:3032730333, 1995.[Abstract/Free Full Text]
-
Bonventre J. Calcium and calcium-related signalling pathways in glomerular mesangial cells. Clin Exp Pharmacol Physiol 23:6570, 1996.[Medline]
-
Schlondorff D. Roles of the mesangium in glomerular function. Kidney Int 49:15831585, 1996.[Medline]
-
Marks AR. Intracellular calcium-release channels: regulators of cell life and death. Am J Physiol 272:H597H605, 1997.[Abstract/Free Full Text]
-
Berridge MJ. Calcium signalling and cell proliferation. Bioessays 17:491500, 1995.[Medline]
-
Berridge MJ. Inositol trisphosphate and calcium signalling. Nature 361:315325, 1993.[Medline]
-
Clapper D, Walseth T, Dargie P, Lee H. Pyridine nucleotide metabolites stimulate calcium release from sea urchin egg microsomes desensitized to inositol trisphosphate. J Biol Chem 262:95619568, 1987.[Abstract/Free Full Text]
-
Li Q, Yamada Y, Yasuda K, Ihara Y, Okamoto Y, Kaisaki PJ, Watanabe R, Ikeda H, Tsuda K, Seino Y. A cloned rat CD38-homologous protein and its expression in pancreatic islets [published erratum appears in Biochem Biophys Res Commun 1994 204(2):1001]. Biochem Biophys Res Commun 202:629636, 1994.[Medline]
-
Genazzani A, Empson R, Galione A. Unique inactivation properties of NAADP-sensitive Ca2+ release. J Biol Chem 271:1159911602, 1996.[Abstract/Free Full Text]
-
Pozzan T, Rizzuto R, Volpe P, Meldolesi J. Molecular and cellular physiology of intracellular calcium stores. Physiol Rev 74:595636, 1994.[Free Full Text]
-
da Silva CP, Guse AH. Intracellular Ca2+ release mechanisms: multiple pathways having multiple functions within the same cell type? Biochim Biophys Acta 1498:122133, 2000.[Medline]
-
Worley PF, Baraban JM, Supattapone S, Wilson VS, Snyder SH. Characterization of inositol trisphosphate receptor binding in brain: regulation by pH and calcium. J Biol Chem 262:1213212136, 1987.[Abstract/Free Full Text]
-
Chini E, Liang M, Dousa T. Differential effect of pH upon cyclic-ADP-ribose and nicotinate adenine dinucleotide phosphate-induced Ca2+ release systems. Biochem J 335:499504, 1998.
-
Furuichi T, Yoshikawa S, Miyawaki A, Wada K, Maeda N, Mikoshiba K. Primary structure and functional expression of the inositol 1,4,5-trisphosphate-binding protein P400. Nature 342:3238, 1989.[Medline]
-
Marks AR, Tempst P, Chadwick CC, Riviere L, Fleischer S, Nadal-Ginard B. Smooth muscle and brain inositol 1,4,5-trisphosphate receptors are structurally and functionally similar. J Biol Chem 265:2071920722, 1990.[Abstract/Free Full Text]
-
Zhang ZD, Kwan CY, Daniel EE. Subcellular-membrane characterization of [3H]ryanodine-binding sites in smooth muscle. Biochem J 290:259266, 1993.
-
Giannini G, Clementi E, Ceci R, Marziali G, Sorrentino V. Expression of a ryanodine receptor-Ca2+ channel that is regulated by TGF-ß. Science 257:9194, 1992.[Abstract/Free Full Text]
-
Meszaros LG, Bak J, Chu A. Cyclic ADP-ribose as an endogenous regulator of the non-skeletal type ryanodine receptor Ca2+ channel. Nature 364:7679, 1993.[Medline]
-
Guse AH, da Silva CP, Berg I, Skapenko AL, Weber K, Heyer P, Hohenegger M, Ashamu GA, Schulze-Koops H, Potter BV, Mayr GW. Regulation of calcium signalling in T lymphocytes by the second messenger cyclic ADP-ribose. Nature 398:7073, 1999.[Medline]
-
Bourguignon LY, Chu A, Jin H, Brandt NR. Ryanodine receptor-ankyrin interaction regulates internal Ca2+ release in mouse T-lymphoma cells. J Biol Chem 270:1791717922, 1995.[Abstract/Free Full Text]
-
Zhang X, Wen J, Bidasee K, Besch H, Wojcikiewicz J, Lee B, Rubin R. Ryanodine and inositol trisphosphate receptors are differentially distributed and expressed in rat parotid gland. Biochem J 340:519527, 1999.
-
Genazzani A, Mezna M, Dickey D, Michelangeli F, Walseth T, Galione A. Pharmacological properties of the Ca2+-release mechanism sensitive to NAADP in the sea urchin egg. Br J Pharmacol 121:14891495, 1997.[Medline]
-
Lee H. Calcium signaling by cyclic ADP-ribose and NAADP. Cell Biochem Biophys 28:117, 1998.[Medline]
-
Patel S, Churchill GC, Sharp T, Galione A. Widespread distribution of binding sites for the novel Ca2+-mobilizing messenger, nicotinic acid adenine dinucleotide phosphate, in the brain. J Biol Chem 275:3649536497, 2000.[Abstract/Free Full Text]
-
Galione A, McDougall A, Busa WB, Willmott N, Gillot I, Whitaker M. Redundant mechanisms of calcium-induced calcium release underlying calcium waves during fertilization of sea urchin eggs. Science 261:348352, 1993.[Abstract/Free Full Text]
-
Lee HC, Aarhus R, Walseth TF. Calcium mobilization by dual receptors during fertilization of sea urchin eggs. Science 261:352355, 1993.[Abstract/Free Full Text]
-
Petersen OH, Cancela JM. New Ca2+-releasing messengers: are they important in the nervous system? Trends Neurosci 22:488495, 1999.[Medline]
-
Jayaraman T, Ondriasova E, Ondrias K, Harnick DJ, Marks AR. The inositol 1,4,5-trisphosphate receptor is essential for T-cell receptor signaling. Proc Natl Acad Sci U S A 92:60076011, 1995.[Abstract/Free Full Text]
-
Go L, Moschella M, Watras J, Handa K, Fyfe B, Marks A. Differential regulation of two types of intracellular calcium release channels during end-stage heart failure. J Clin Invest 95:888894, 1995.
Received for publication June 13, 2001.
Accepted for publication August 27, 2001.
This article has been cited by other articles:

|
 |

|
 |
 
T. L. Thai and W. J. Arendshorst
ADP-ribosyl cyclase and ryanodine receptors mediate endothelin ETA and ETB receptor-induced renal vasoconstriction in vivo
Am J Physiol Renal Physiol,
August 1, 2008;
295(2):
F360 - F368.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
V. Sathish, F. Leblebici, S. N. Kip, M. A. Thompson, C. M. Pabelick, Y. S. Prakash, and G. C. Sieck
Regulation of sarcoplasmic reticulum Ca2+ reuptake in porcine airway smooth muscle
Am J Physiol Lung Cell Mol Physiol,
April 1, 2008;
294(4):
L787 - L796.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. A. Jude, M. E. Wylam, T. F. Walseth, and M. S. Kannan
Calcium Signaling in Airway Smooth Muscle
Proceedings of the ATS,
January 1, 2008;
5(1):
15 - 22.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. K. Fellner and W. J. Arendshorst
Angiotensin II-stimulated Ca2+ entry mechanisms in afferent arterioles: role of transient receptor potential canonical channels and reverse Na+/Ca2+ exchange
Am J Physiol Renal Physiol,
January 1, 2008;
294(1):
F212 - F219.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. Soares, M. Thompson, T. White, A. Isbell, M. Yamasaki, Y. Prakash, F. E. Lund, A. Galione, and E. N. Chini
NAADP as a second messenger: neither CD38 nor base-exchange reaction are necessary for in vivo generation of NAADP in myometrial cells
Am J Physiol Cell Physiol,
January 1, 2007;
292(1):
C227 - C239.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. Wang, A. G. Teschemacher, J. F. R. Paton, and S. Kasparov
Mechanism of nitric oxide action on inhibitory GABAergic signaling within the nucleus tractus solitarii
FASEB J,
July 1, 2006;
20(9):
1537 - 1539.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
H. C. Lee
Nicotinic Acid Adenine Dinucleotide Phosphate (NAADP)-mediated Calcium Signaling
J. Biol. Chem.,
October 7, 2005;
280(40):
33693 - 33696.
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A. Galione and O. H. Petersen
The NAADP Receptor: New Receptors or New Regulation?
Mol. Interv.,
April 1, 2005;
5(2):
73 - 79.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. K. Fellner and W. J. Arendshorst
Angiotensin II Ca2+ signaling in rat afferent arterioles: stimulation of cyclic ADP ribose and IP3 pathways
Am J Physiol Renal Physiol,
April 1, 2005;
288(4):
F785 - F791.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. K. Fellner and L. Parker
Endothelin-1, superoxide and adeninediphosphate ribose cyclase in shark vascular smooth muscle
J. Exp. Biol.,
March 15, 2005;
208(6):
1045 - 1052.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A. Pflueger, A. J. Croatt, T. E. Peterson, L. A. Smith, L. V. d'Uscio, Z. S. Katusic, and K. A. Nath
The hyperbilirubinemic Gunn rat is resistant to the pressor effects of angiotensin II
Am J Physiol Renal Physiol,
March 1, 2005;
288(3):
F552 - F558.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
N. P. Kinnear, F.-X. Boittin, J. M. Thomas, A. Galione, and A. M. Evans
Lysosome-Sarcoplasmic Reticulum Junctions: A TRIGGER ZONE FOR CALCIUM SIGNALING BY NICOTINIC ACID ADENINE DINUCLEOTIDE PHOSPHATE AND ENDOTHELIN-1
J. Biol. Chem.,
December 24, 2004;
279(52):
54319 - 54326.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
R. Laporte, A. Hui, and I. Laher
Pharmacological Modulation of Sarcoplasmic Reticulum Function in Smooth Muscle
Pharmacol. Rev.,
December 1, 2004;
56(4):
439 - 513.
[Abstract]
[Full Text]
[PDF]
|
 |
|