|
|
||||||||






* Pathophysiology Research Team, National Institute for Environmental Studies, Ibaraki, Japan;
Department of Health Sciences, Oita University of Nursing and Health Sciences, Oita, Japan;
Department of Hygiene Chemistry, Faculty of Pharmaceutical Sciences, Tokyo University of Science, Chiba, Japan;
Department of Pharmacology, Kobe Pharmaceutical University, Kobe, Japan; || Department of Environmental Medicine, Institute of Community Medicine, University of Tsukuba, Ibaraki, Japan; and ¶ Inflammation and Immunology, Kyoto Prefectural University of Medicine, Kyoto, Japan.
1 To whom requests for reprints should be addressed at Pathophysiology Research Team, National Institute for Environmental Studies, 16-2 Onogawa, Tsukuba, Ibaraki, 305-8506, Japan. E-mail: htakano{at}nies.go.jp.
| Abstract |
|---|
|
|
|---|
2-fold as compared with their expression levels in the vehicle group was greater in the LPS group than in other groups, but treatment with DEP and LPS dramatically increased the number of the genes upregulated
6-fold. In particular, gene expression of metallothionein-1 and -2, S100 calcium-binding protein A9, lipocalin 2, and small inducible cytokine B family member 10 was higher by
20-fold in the DEP + LPS group than in the vehicle group. These results were concomitant with those obtained by real-time reverse transcriptionpolymerase chain reaction analysis in the overall trend. Our findings suggest that intense, focused expression of genes such as S100 calcium-binding protein A9, lipocalin 2, and small inducible cytokine B family member 10 relates to the synergistic aggravation of acute lung injury by LPS and DEP rather than weak, broad expression of various genes by exposure of LPS alone.
Key Words: acute lung injury cDNA microarray lipopolysaccharide diesel exhaust particles
| Introduction |
|---|
|
|
|---|
Lipopolysaccharide (LPS), a component of the cell wall of gram-negative bacteria, induces or exacerbates a variety of lung diseases, including asthma (8) and acute lung injury (9). Exposure of rodents to LPS recruits neutrophils and increases the expression of proinflammatory molecules (10, 11). Exposure to DEP with LPS or preincubation with LPS before DEP treatment increases interleukin (IL)-1+ secretion in peripheral blood mono-nuclear cells (12). We have recently shown that DEP synergistically enhance neutrophilic lung inflammation related to LPS in mice (13). This synergistic enhancement has been concomitant with the increased gene expression of proinflammatory molecules such as IL-1+ and macrophage inflammatory protein 1
(MIP-1
). However, this study has generally been limited to the analysis of only a few genes and therefore has provided little information about the global pattern of gene expression related to DEP in the presence or absence of LPS.
cDNA microarray or DNA-chip technology provides rapid analysis and abundance of information on expressed gene. Previous studies using cDNA microarrays have found that exposure to DEP contributes to pulmonary carcinogenesis in rat lungs (14), to the repair of DNA damage, and to cell proliferation in rat alveolar macrophages (15). However, no previous study has examined the global pattern of gene expression that follows DEP enhancement of inflammatory lung injury.
In the present study, we used cDNA microarray technology to elucidate the effects of DEP on the global pattern of gene expression related to LPS in the murine lung. The results were further confirmed by using real-time transcriptionpolymerase chain reaction (RT-PCR) analysis. Our studies showed that DEP in the presence of LPS markedly enhanced the expression of five genes, which might be responsible for the synergistic aggravation of LPS-induced acute lung injury.
| Materials and Methods |
|---|
|
|
|---|
Collection of DEP.
A 4JB1-type, light-duty, four-cylinder, 2.74-L, Isuzu diesel engine (Isuzu Automobile Co., Tokyo, Japan) under computer control was connected to a dynamometer (Meiden-sha, Tokyo, Japan). The engine was operated on standard diesel fuel at 1500 rpm under a load of 10 torques (kg/m). DEP were collected as previously described (16). The mass median aerodynamic diameter of DEP was 0.4 µm by analysis of an Anderson Air Sampler (Shibata Science Technology, Tokyo, Japan). Most of the particles were globular in shape.
Study Protocol.
The mice were randomly allocated to four experimental groups. The vehicle group received 1x phosphate-buffered saline (PBS) at pH 7.4 (Invitrogen Corp., Carlsbad, CA) containing 0.025% Tween 80 (Nacalai Tesque, Kyoto, Japan). The DEP group received 250 µg DEP in the same vehicle. The LPS (Escherichia coli B55: 05; Difco Lab, Detroit, MI) group received 100 µg LPS in the same vehicle, the DEP + LPS group received both 250 µg DEP and 100 µg LPS in the same vehicle, and the suspensions were sonicated for 2 mins with an ultrasonic disruptor (UD-201; Tomy Seiko, Tokyo, Japan). Each group of mice was anesthetized with 4% halothane (Takeda Chemical Industries Ltd., Osaka, Japan) and then intra-tracheally inoculated with 100-µl aliquots via a polyethylene tube. The endotoxin activity, which was determined by Limulus Amebocyte Lysate assay (Seikagaku-kogyo, To-kyo, Japan), was lower than the detection limit (0.001 EU/ml) in the vehicle solutions and DEP solutions (n = 8 in each solution).
Extraction of mRNA.
Total RNAs were extracted with ISOGEN (Nippon Gene, Tokyo, Japan) according to the manufacturers instructions. Poly(A)+ mRNA for cDNA microarray analysis was prepared by using OligotexdT30 mRNA Purification Kits (TaKaRa, Kyoto, Japan) according to the manufacturers protocol.
Fluorescent Labeling of Probe.
Isolated mRNA was reverse transcribed with 5'Cy3 or Cy5 labeled random 9-mers (Operon Technologies Inc., Alameda, CA). Reaction mixtures were incubated for 2 hrs at 37°C with 200 ng polyA RNA, 200 units Moloney murine leukemia virus reverse transcriptase (Invitrogen), 4 mM dithiothreitol (DTT), 1 unit RNase Inhibitor (Ambion, Austin, TX), 0.5 mM deoxynucleotide triphosphates (dNTPs), and 2 µg labeled 9-mers in 25-µl volume with enzyme buffer supplied by the manufacturer (Invitrogen). The reactions were terminated by incubation at 85°C for 5 mins. The paired reactions were combined and purified with a TE-30 column (Clontech, Palo Alto, CA), brought to 90 µl with dH2O, and then precipitated with 2 µl of 1 mg/ml glycogen, 60 µl 5M NH4OAc, and 300 µl ethanol. After centrifugation the supernatant was decanted and the pellet was resus-pended in 24 µl of hybridization buffer, which consisted of 5X SSC, 0.2% sodium dodecyl sulfate, 1 mM DTT.
Hybridization and Scanning.
Hybridization was carried out by using the LifeArray (Incyte Pharmaceuticals Inc., Palo Alto, CA). The LifeArray contained 9596 mouse cDNA spots, which consisted of 6238 named genes and 3358 expressed sequence tags. Probe solutions were thoroughly resuspended by incubating at 65°C for 5 mins with mixing. The probe was applied to the array and covered with a 22-mm2 glass coverslip and placed in a sealed chamber to prevent evaporation. After hybridization at 60°C for 6.5 hrs, slides were washed in three consecutive washes of decreasing ionic strength. Microarrays were scanned in both Cy3 and Cy5 channels with Axon GenePix scanners (Foster City, CA) with a 10-mm resolution. The signal was converted into 16-bits-per-pixel resolution, yielding a 65,536-count dynamic range.
Normalization and Ratio Determination.
Incyte GEMtools software (Incyte Pharmaceuticals) was used for image analysis. The element was determined by a gridding and region detection algorithm. The area surrounding each element image was used to calculate a local background and was subtracted from the total element signal. Background-subtracted element signals were used to calculate Cy3:Cy5 ratios. The average of the resulting total Cy3 and Cy5 signal gives a ratio that was used to balance or normalize the signals.
cDNA Synthesis.
Total RNA was treated with DNase I (TaKaRa) for 10 mins at 37°C. The mixture was purified with phenol/chloroform/isoamyl alcohol. This RNA was reverse transcribed in a 40-µl reaction of 1 mM dNTPs, 10mM Tris-HCl pH8.3, 50 mM KCl, 5 mM MgCl2, 2.5 µM random hexamer, 1 unit/µl RNase inhibitor, and 1 unit/µl murine leukemia virus (MuLV) reverse transcriptase (Perkin-Elmer Corp., Foster City, CA). Reverse transcription was carried out at 42°C for 15 mins and at 99°C for 5 mins. The mixture was then cooled to 5°C and stored at -20°C until use.
RT-PCR Analysis.
The quantitation of mRNA expression was carried out by the ABI Prism 7000 Sequence Detection System (Perkin-Elmer) according to the manufacturers instructions. Oligonucleotide hybridization probes (TaqMan probe) were labeled with a 5' fluorescent reporter dye (6FAM or VIC) and a 3' quencher dye (TAMRA). The 5' to 3' nuclease activity of Taq DNA polymerase cleaved the probe and released the reporter, whose fluorescence was detected by the laser detector of the ABI Prism 7000. The fluorescent increase was monitored during the complete amplification. The quantitation of gene expression was derived from the cycle number at which the fluorescent signal crossed a threshold in the exponential phase of the PCR reaction by using the standard curve method according to the manufacturers protocol. The relative intensity was normalized to an endogenous control gene (18S rRNA). The PCR amplification performed with a 20-µl final reaction mixture consisting of 10 µl 2x TaqMan Universal PCR Master mix (Perkin-Elmer), 2 µl 20X Assay mix (contained with TaqMan probe and pair primers), and 1 µl cDNA. cDNAs were amplified according to the thermal profile of 50°C for 2 mins and then 95°C for 10 mins, followed by 40 cycles at 95°C for 15 secs and 60°C for 1 min. PCR primer pairs and the TaqMan probe were designed and purchased from Perkin-Elmer. The primer and probe sequences are listed below. In all cases, the forward primer, reverse primer, and probe sequences were (i) metallothionein (MT) 2, CGCCATGGACCCCAACT, CAGGAAGTACATTTGCATTGTTTGC, and 6FAM-CCTCCGATGGATCCTG-TAMRA; (ii) S100 calcium-binding protein A9 (S100A9), AACAAAGCACCTTCT-CAGATGGA, GGTGTCCTTCCTTCCTAGAGTATTG, and 6FAM-CAGATAACCACCATCATCG-TAMRA; (iii) lipocalin 2, GCACACATCAGACCTAGTAGCTG, C A A G G C C C A G A C A C A T G A C A , a n d 6 F A M -TCAGGGCCATGGTTTC-TAMRA; and (iv) small inducible cytokine B family member 10 (SYCB-10), TCCA-GATGCCAACCTTCCG, GGCAGCACTTGGGTTCATG, and 6FAM-AAGCCTCCCCATCAGCA-TAMRA. The sequences of 18S rRNA and MT-1, which we purchased from PerkinElmer, were not disclosed by the manufacturer.
Statistical Analysis.
Data were reported as mean ± SEM. Differences among groups were determined by ANOVA with post hoc test as previously described (Stat view version 5.0; Abacus Concepts Inc., Berkeley, CA) (7).
| Results |
|---|
|
|
|---|
2-fold increased as compared with their expression levels in the vehicle group. Whereas 1073 genes were upregulated in the LPS group, only 38 and 204 were upregulated in the DEP and DEP + LPS groups, respectively (Table 1
6-fold increased expression, 26 genes were upregulated after combined instillation of DEP and LPS as compared with 18 genes upregulated after LPS instillation and 3 upregulated by DEP administration (Table 2
20-fold in the DEP + LPS group but not in the LPS group (Table 2
|
|
|
| Discussion |
|---|
|
|
|---|
in the lung and of soluble intercellular adhesion molecule 1 in the serum. In the present study, we used cDNA microarray technology to elucidate the effects of DEP on the global pattern of LPS-related gene expression in the murine lung. The results have shown that administration of DEP or LPS or both elevates the expression of various genes as compared with their expression levels induced by vehicle group (Table 1
2-fold in the LPS group than in the other groups (Table 1
6-fold (Table 2
20-fold in the DEP + LPS group compared with their levels in the vehicle group (Table 2
Previous reports have suggested that DEP affect the respiratory and immune systems in vivo and in vitro. We have recently shown that DEP synergistically enhance acute lung injury related to LPS (13). The acute lung injury involved neutrophilic inflammation, lung edema, and alveolar hemorrhage. The enhancement has been concomitant with the increased expression of proinflammatory molecules, including IL-1ß, MIP-1
, tumor necrosis factor-
(TNF-
), macrophage chemoattractant protein 1, kerati-nocyte chemoattractant, and soluble intercellular adhesion molecule 1 (13). However, our previous study has provided little information on the genes responsible for the synergistic aggravation of acute lung injury after combined exposure to DEP and LPS. In the present study, we used cDNA microarrays to the analysis of the global gene expression pattern in the murine lung after exposure to DEP or LPS. It has been previously reported that exposure of rats to diesel exhaust induces mRNAs for A-raf and proliferating cell nuclear antigen, which are associated with pulmonary carcinogenesis (14). Koike et al. (15) have shown that exposure of rat alveolar macrophages to DEP extract increases the gene expression for heme oxygenase 1, heme oxygenase 2, thioredoxin peroxidase 2, glutathione S-transferase P subunit, NAD(P)H dehydrogenase, and proliferating cell nuclear antigen. Our present study showed that DEP modified the global pattern of gene expression in the presence or absence of LPS. Far more genes were activated
2-fold (relative to levels in the vehicle group) in the LPS group than in the other groups, but combined exposure to DEP and LPS greatly increased the number of genes that were upregulated
6-fold. In particular, the gene expression of MT-1, MT-2, S100A9, lipocalin 2, and SYCB-10 was increased by
20-fold in the DEP + LPS group but not in the LPS group (Table 2
). These results indicate that combined instillation of DEP and LPS, which causes severe acute lung injury, induces more intense and specific expression of a limited number of the genes. Interestingly, the synergistic aggravation of acute lung injury by combined exposure to DEP and LPS was paralleled by the intense, focused expression of a few genes rather than the weak, broad expression of multiple genes that is induced by LPS alone.
Among the genes markedly upregulated by combined administration of DEP and LPS, S100A9 is a constitutive cytoplasmic protein in neutrophils (17). The S100A9-positive leukocytes belong to the first group of cells that invade inflammatory sites and are considered to be part of the nonspecific first line of defense against inflammatory agents. Recent reports have suggested that S100A9 is involved in the molecular processes leading to adhesion or transmigration. Extracellular S100A9 modulates the affinity of the Mac-1 integrin receptor via a G-proteinmediated mechanism (18). Furthermore, passive immunization with anti-S100A9 has inhibited the neutrophilia associated with LPS injection into the murine air pouch (19). Therefore, it is plausible that S100A9 is associated with the synergistic enhancement of acute lung injury caused by LPS and DEP.
Lipocalins are small, secreted proteins that play a role in diverse biological processes through the binding of small hydrophobic molecules and interaction with cell surface receptors (20). The lipocalin 2 sequence is 96% homologous to lipocalin 24p3 gene, a member of the lipocalin superfamily in mice. Lipocalin 24p3 binds a potent neutrophil chemoattractant (21) and possibly other lipophilic mediators of inflammation (22). Lipocalin 2 might play a similar role to lipocalin 24p3 in LPS-related inflammation. In addition, lipocalin 24p3 delivers iron to the cytoplasm, where it activates or represses iron-responsive genes (23). DEP contain a variety of heavy metals such as iron and copper (24) and generate hydroxyl radicals in the murine lungs through an iron-catalyzed reaction of superoxide and H2O2 (25). The synergistic aggravation of acute lung injury caused by DEP and LPS might, at least in part, be related to the iron in DEP and to the expression of lipocalin 2.
SYCB-10 is an interferon (IFN)-
inducible protein and a member of a small group of T-cell chemoattractants that activate the CXCR3 receptor (26). In our previous study, the DEP + LPS group showed an increase in the protein level of INF-
in the lung tissue as compared with the vehicle group (data not shown). The functions of SYCB-10 have not been clarified, but it may play a role in the aggravation of acute lung injury in our model.
Metallothioneins are lowmolecular-weight, cysteine-rich, heavy metal-binding proteins that are easily induced by heavy metals, hormones, acute stress, and various chemicals (27). MT-1 and MT-2 are expressed in all tissues and play important roles in zinc and copper homeostasis, detoxification of heavy metals, and scavenging of free radicals (28). DEP consist of carbonaceous nuclei, a variety of organic chemicals that generate free radicals (16, 2932), and heavy metals such as iron and copper (24). On the other hand, exposure of rats to LPS has elevated the gene expression of metallothionein in the lung (33). Expression of the MT-1 and MT-2 genes might play a role in the pulmonary defense against the heavy metals in DEP or the oxidative stress caused by DEP as well as against LPS.
Our present study showed that combined administration of DEP and LPS markedly elevated the expression of molecules related to neutrophilic inflammation, such as serum amyloid A3, neutrophilic granule protein, small inducible cytokine A4, intercellular adhesion molecule, IL-1ß, and LPS-induced TNF-
(Table 2
). The expression levels of these genes were higher in the DEP + LPS group than in the other groups. In our previous study, the protein expression of IL-1ß and soluble intercellular adhesion molecule-1 was paralleled by the mRNA expression of these molecules (13). Future studies should further examine the correlation between mRNA and protein expressions of a variety of molecules by using protein-chip technology.
In conclusion, DEP elevated the expression of a variety of genes in the murine lung in the presence or absence of LPS. In particular, combined exposure to DEP and LPS markedly increased the gene expression for MT-1, MT-2, S100A9, lipocalin 2, and SYCB-10, which showed increases
20-fold as compared with their expression levels after vehicle exposure. The expression of these molecules might be related to acute lung injury caused by combined exposure to DEP and LPS. The results obtained by cDNA microarray analysis were consistent with those from RT-PCR analysis in the overall trend. cDNA microarray analysis may be effective for elucidating the genes involved in biological pathways associated with DEP-related lung inflammation.
| Acknowledgments |
|---|
Received for publication March 5, 2004. Accepted for publication August 2, 2004.
| References |
|---|
|
|
|---|
This article has been cited by other articles:
![]() |
A. A. Nemec, G. D. Leikauf, B. R. Pitt, K. J. Wasserloos, and A. Barchowsky Nickel Mobilizes Intracellular Zinc to Induce Metallothionein in Human Airway Epithelial Cells Am. J. Respir. Cell Mol. Biol., July 1, 2009; 41(1): 69 - 75. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. L. Heidenfelder, D. M. Reif, J. R. Harkema, E. A. Cohen Hubal, E. E. Hudgens, L. A. Bramble, J. G. Wagner, M. Morishita, G. J. Keeler, S. W. Edwards, et al. Comparative Microarray Analysis and Pulmonary Changes in Brown Norway Rats Exposed to Ovalbumin and Concentrated Air Particulates Toxicol. Sci., March 1, 2009; 108(1): 207 - 221. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. Yanagisawa, H. Takano, T. Ichinose, K. Mizushima, M. Nishikawa, I. Mori, K.-i. Inoue, K. Sadakane, and T. Yoshikawa Gene Expression Analysis of Murine Lungs Following Pulmonary Exposure to Asian Sand Dust Particles Experimental Biology and Medicine, September 1, 2007; 232(8): 1109 - 1118. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Ding and L. A. Toth mRNA expression in mouse hypothalamus and basal forebrain during influenza infection: a novel model for sleep regulation Physiol Genomics, February 23, 2006; 24(3): 225 - 234. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. C. Barnes Genetic Determinants and Ethnic Disparities in Sepsis-associated Acute Lung Injury Proceedings of the ATS, October 1, 2005; 2(3): 195 - 201. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. M. St. Croix, K. Leelavaninchkul, S. C. Watkins, V. E. Kagan, and B. R. Pitt Nitric Oxide and Zinc Homeostasis in Acute Lung Injury Proceedings of the ATS, October 1, 2005; 2(3): 236 - 242. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |