EBM Email Content Delivery
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF) Free
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Cleary, M. P.
Right arrow Articles by Maihle, N. J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Cleary, M. P.
Right arrow Articles by Maihle, N. J.
Experimental Biology and Medicine 229:182-193 (2004)
© 2004 Society for Experimental Biology and Medicine


ORIGINAL RESEARCH ARTICLE

Leptin Receptor–Deficient MMTV-TGF-{alpha}/LeprdbLeprdb Female Mice Do Not Develop Oncogene-Induced Mammary Tumors

Margot P. Cleary*,1, Subhash C. Juneja{dagger}, Frederick C. Phillips*, Xin Hu*, Joseph P. Grande{ddagger} and Nita J. Maihle{ddagger},2

* Hormel Institute, University of Minnesota, 801 16th Avenue NE, Austin, Minnesota 55912; and Departments of {dagger} Laboratory Medicine and Pathology and {ddagger} Biochemistry and Molecular Biology, Mayo Foundation, Rochester, Minnesota 55905

1 To whom requests for reprints should be addressed at Hormel Institute, University of Minnesota, 801 16th Avenue N.E., Austin, MN 55912. E-mail: mpcleary{at}hi.umn.edu


    Abstract
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Being overweight is a risk factor for postmenopausal breast cancer and is associated with an increased incidence and shortened latency of spontaneous and chemically induced mammary tumors in rodents. However, leptin-deficient obese LepobLepob female mice have reduced incidences of spontaneous and oncogene-induced mammary tumors. Of interest, leptin enhances the proliferation of human breast cancer cell lines in which leptin receptors are expressed, which suggests that leptin signaling plays a role in tumor development. We evaluated oncogene-induced mammary tumor development in obese MMTV-TGF-{alpha}/LeprdbLeprdb mice that exhibit a defect in OB-Rb, which is considered to be the major signaling isoform of the leptin receptor. Lepr and MMTV-TGF-{alpha} mice were crossed, and the offspring were genotyped for oncogene expression and the determination of Lepr status. Lean MMTV-TGF-{alpha}/Lepr+Lepr+ (homozygous) and MMTV-TGF-{alpha}/Lepr+Leprdb (heterozygous) mice and obese MMTV-TGF-{alpha}/LeprdbLeprdb mice were monitored until age 104 weeks. Body weights of MMTV-TGF-{alpha}/ LeprdbLeprdb mice were significantly heavier than those of the lean groups. No mammary tumors were detected in MMTV-TGF-{alpha}/LeprdbLeprdb mice, whereas the incidence of mammary tumors in MMTV-TGF-{alpha}/Lepr+Lepr+ and MMTV-TGF-{alpha}/ Lepr+Leprdb mice was 69% and 82%, respectively. Examination of mammary tissue whole mounts indicated an absence of duct formation and branching for MMTV-TGF-{alpha}/LeprdbLeprdb mice. Both age at mammary tumor detection and tumor burden (tumors/mouse and tumor weights) were similar for the lean genotypes. Serum leptin levels of MMTV-TGF-{alpha}/LeprdbLeprdb mice were 12–20-fold higher than levels of lean mice. Thus, despite elevated serum leptin levels, leptin receptor–deficient MMTV-TGF-{alpha}/LeprdbLeprdb mice do not develop mammary tumors. This study provides additional evidence that leptin and its cognate receptor may be involved in mammary tumorigenesis.

Key Words: leptin • leptin receptor • breast cancer • mice • obesity • OB-Rb


    Introduction
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Elevated body weight and obesity are risk factors for postmenopausal breast cancer (19). Furthermore, higher body weight is associated with an increased incidence and shortened latency of spontaneous and chemically induced mammary tumors (MTs) in rodents (1015). However, although genetically obese female LepobLepob mice exhibited a shortened latency for development of spontaneous MTs compared with lean mice, they had a significantly lower tumor incidence (16). In addition, we recently reported that obese female MMTV-TGF-{alpha}/LepobLepob mice did not develop oncogene-induced MTs, whereas homozygous MMTV–TGF-{alpha}/Lep+Lep+ and heterozygous MMTV–TGF-{alpha}/Lep+Lepob lean mice had incidence rates of 50% and 67%, respectively, at age 104 weeks (17). The genetic defect responsible for obesity in LepobLepob mice is a deficiency of the cytokine-like protein, leptin (18). The results of recent in vitro studies have indicated that the addition of leptin enhances the cellular proliferation of breast epithelial and malignant cell lines and that these cell lines express the leptin receptor (1922).

The integration of these in vivo and in vitro study results led us to hypothesize that the absence of MT development in obese MMTV–TGF-{alpha}/LepobLepob mice could potentially be attributed to their leptin deficiency. To more conclusively establish a role for leptin action and signaling in the development of both normal and malignant breast and mammary tissues, we have determined the effect of leptin receptor deficiency on oncogene-induced MT development. The leptin receptor-deficient LeprdbLeprdb mouse provides a model to undertake such an evaluation. LeprdbLeprdb mice have a mutation in the gene that encodes the long isoform of the leptin receptor designated as OB-Rb (or OB-Rl) (23). OB-Rb is considered to be the major signaling form of this protein (24). Here we present the results of cross-breeding Lepr strain mice with mice that overexpress human transforming growth factor (TGF)–{alpha} that has been placed under the control of the mouse mammary tumor virus promoter/enhancer (MMTV–TGF-{alpha} mice). These mice were originally described by Matsui et al. (25). Homozygous MMTV–TGF-{alpha}/Lepr+Lepr+ and heterozygous MMTV–TGF-{alpha}/Lepr+Leprdb lean mice and homozygous MMTV–TGF-{alpha}/LeprdbLeprdb obese mice were monitored until age 104 weeks, to determine MT latency and incidence rates.


    Materials and Methods
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Mice.
Breeding pairs of MMTV–TGF-{alpha} mice were originally obtained from Jackson Laboratory (Bar Harbor, ME) and are maintained at the Hormel Institute on the C57BL6 background. Lepr strain mice were obtained from Pennington Biomedical Research Center (Baton Rouge, LA). These Lepr mice are also maintained on the C57BL6 background but do not carry the misty gene mutation that affects body weight, length, and body fat (26). Male MMTV–TGF-{alpha}/Lepr+Leprdb mice were mated with non-transgenic Lepr+Leprdb female mice. This was necessary because MMTV–TGF-{alpha} female mice, although fertile, are unable to lactate (27, 28). This breeding strategy resulted in the production of all three Lepr genotypes. Offspring were maintained with their mothers until age 4 weeks and then were removed and housed with others of the same sex prior to genotyping.

DNA Isolation and Genotyping.
Tail biopsy samples were obtained at age 5–7 weeks for genotype analysis. For genomic DNA extraction, tissues were digested as described elsewhere (17). Mice were genotyped to identify the presence of TGF-{alpha} using oligonucleotide primer 199, which was designed by Jackson Laboratory (5'GATCTTTTCTATGGAATAAGGAATGGA) and corresponds to a region of the MMTV vector just upstream of the TGF-{alpha} insert; the complementary primer 200 (5'GATC-CAGTGTGACCTAGAGAAGAAAT) corresponds to a region within the TGF-{alpha} insert. The genotypes of Lepr mice were determined by modifications of an assay procedure originally developed by Dr. Gary Truett. The primers used were Leprdb40R (5'-GTTATTTCTTAGTCATTCAAACC-ATAGTTTAGGTTTGGTT-3') and Leprdb30F (5'-CGG-ACACTCTTTGAAGTCTCTCATGACCAC-3'). In brief, genomic DNA was added to a mixture of deoinized H2O, polymerase chain reaction (PCR) buffer, 25 mM MgCl2, 2.5 mM DNTPs, 2 µM each primer, and Taq DNA polymerase. The PCR protocol included 40 cycles at 95ºC for 40 secs and 66ºC for 60 secs. The restriction digest of the PCR products included a mixture of deionized H2O, PCR buffer (Mg free; Promega), loading buffer (60% sucrose/1 mM cresol red), and 10 U/µl Bst E II (New England Biolabs) for 1 hr at 60ºC. After digestion, the sample was subjected to agarose gel electrophoresis, which resulted in three distinct patterns that distinguished homozygous (Lepr+Lepr+) lean, heterozygous (Lepr+Leprdb) lean, and homozygous (LeprdbLeprdb) obese mice from one another.

Animal Housing.
Mice were enrolled in the study at age 6 weeks. Forty mice were included in the MMTV–TGF-{alpha}/Lepr+Lepr+ group, 41 in the MMTV–TGF-{alpha}/Lepr+Leprdb group, and 43 in the MMTV–TGF-{alpha}/LeprdbLeprdb group. Mice usually were housed in pairs and provided commercial rodent food (Rodent Chow Diet 5001; PMI Nutrition International, Inc., St. Louis, MO) and water ad libitum. Twelve-hour light (0700–1900) and 12-hr dark (1900–0700) cycles were maintained, as well as a constant humidity level of 50%. The Hormel Institute Animal Facility is accredited by the Association for Assessment and Accreditation of Laboratory Animal Care. The University of Minnesota Institutional Animal Care and Use Committee approved the study and procedures.

Characterization of Tumors.
Body weights were determined weekly, at which time the mice also were palpated for the presence of MTs. Once MTs were detected, their growth was monitored with calipers. Mice were sacrificed for the following reasons: excessive weight loss, MT growth >20 mm in length, lethargy, unhealed sores, or age 104 weeks. At necropsy, a blood sample was obtained by heart puncture. Retroperitoneal and parametrial fat pads were removed and weighed. In addition, liver, kidneys, heart, spleen, lungs, and ovaries were removed and weighed. Samples from organs and tissues (except adipose) were fixed in 10% neutral buffered formalin for 24–48 hrs and then embedded in paraffin. Five-micron sections were prepared and deparaffinized by multiple rinsing with xylene and then rehydrated with ethanol solutions. Sections were stained with hematoxylin and eosin. Histopathological analysis was conducted in a blinded fashion, without prior knowledge of Lepr genotype. Whole mammary fat pads were excised, fixed in acetone, stained with hematoxylin, destained, and placed in Permount (Sigma Chemical) on a glass slide with a glass cover slip.

Serum Leptin.
Serum leptin was determined using commercially available radioimmunoassay kits specific for mice (Linco Research, Inc., St. Charles, MO). Serum samples from MMTV–TGF-{alpha}/LeprdbLeprdb were diluted fourfold, to be in the range of the standards.

Statistics.
Data are presented as means ± SEM. Survival curves were compared by chi-square analysis. Body-weight curve comparisons among the three genotypes were made by one-way ANOVA with repeated measures, followed by a Neuman-Keul’s test to determine which groups were significantly different from each other. Other comparisons among the three groups were made by one-way ANOVA also followed by a Neuman-Keul’s test. Comparisons between the two lean groups with and without MTs were done using two-way ANOVA followed by planned Student’s t test. Comparisons between homozygous and heterozygous mice were made using Student’s t test.


    Results
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Obese MMTV–TGF-{alpha}/LeprdbLeprdb mice died at a significantly younger age than did lean MMTV–TGF-{alpha}/Lepr+Lepr+ and MMTV–TGF-{alpha}/Lepr+Leprdb mice (Fig. 1Go). The average age at death was 53 weeks for MMTV–TGF-{alpha}/LeprdbLeprdb mice, 92 weeks for MMTV–TGF-{alpha}/Lepr+Leprdb lean mice, and 90 weeks for MMTV–TGF-{alpha}/Lepr+Lepr+ lean mice (Table 1Go). MMTV–TGF-{alpha}/ LeprdbLeprdb mice died between ages 12 and 94 weeks, compared with between ages 57 and 104 weeks for MMTV–TGF-{alpha}/Lepr+Leprdb mice and between ages 63 and 104 weeks for MMTV–TGF-{alpha}/Lepr+Lepr+ lean mice. Mice that were alive at age 104 weeks were sacrificed at that point; thus, the age of death for lean mice does not reflect true mortality, but, because of experimental design considerations, this was a necessary termination point. Forty percent (16/40) of MMTV–TGF-{alpha}/Lepr+Lepr+ mice lived to age >=100 weeks, as did 46% (19/41) of MMTV–TGF-{alpha}/Lepr+Leprdb mice.



View larger version (11K):
[in this window]
[in a new window]
 
Figure 1. Survival curves of transforming growth factor (TGF)-{alpha}/Lepr female mice. {blacksquare}, TGF-{alpha}/Lepr+Lepr+ (n = 40). •, TGF-{alpha}/Lepr+Leprdb (n = 41).{blacktriangledown}, TGF-{alpha}/LeprdbLeprdb (n = 43) mice. Chi-square analysis, P < 0.0001.

 

View this table:
[in this window]
[in a new window]
 
Table 1. Age at Death, Final Body Weight, Combineda Fat Pad Weights, Fat Pad:Carcass Ratio, and Serum Leptin for MMTV–TGF-{alpha}/Lepr+ Lepr+ Lean, Lepr+ Leprdb Lean, and LeprdbLeprdb Obese Female Mice
 
As shown in Figure 2Go, body weights of MMTV–TGF-{alpha}/ LeprdbLeprdb mice were significantly heavier than those of lean mice. When body weights of the two lean groups were directly compared, MMTV–TGF-{alpha}/Lepr+Leprdb mice consistently weighed significantly more than MMTV–TGF-{alpha}/ Lepr+Lepr+ mice (not shown). As expected, the final body weight of obese MMTV–TGF-{alpha}/LeprdbLeprdb mice was significantly heavier than those of the lean mice (Table 1Go). Combined fat pad weights of the obese mice also were greater than those of lean mice (Table 1Go). Although they were not significantly different from each other when obese mice were included in the statistical comparison, when only the two lean groups were compared, body and fat pad weights were significantly heavier for MMTV–TGF-{alpha}/Lepr+Leprdb than for MMTV–TGF-{alpha}/Lepr+Lepr+mice. There was a significant difference among all groups for combined fat pad to carcass ratio (MMTV–TGF-{alpha}/LeprdbLeprdb > MMTV–TGF-{alpha}/ Lepr+Leprdb > MMTV–TGF-{alpha}/Lepr+Lepr+; Table 1Go). Serum leptin levels were significantly higher in MMTV–TGF-{alpha}/LeprdbLeprdb mice than in lean mice (Table 1Go). There was a trend for leptin levels of the heterozygous MMTV–TGF-{alpha}/Lepr+Leprdb lean mice to be higher than those of the homozygous MMTV–TGF-{alpha}/Lepr+Lepr+ mice, but this did not reach statistical significance.



View larger version (10K):
[in this window]
[in a new window]
 
Figure 2. Body weight curves of transforming growth factor (TGF)–{alpha}/Lepr female mice.{blacksquare} , TGF-{alpha}/Lepr+Lepr+ (n = 16–40, depending on age).•, TGF-{alpha}/Lepr+Leprdb (n = 16–41, depending on age).{blacktriangledown} TGF-{alpha}/LeprdbLeprdb (n = 2–43, depending on age) mice. ANOVA, P < 0.0001. The weight curve of TGF-{alpha}/LeprdbLeprdb mice was significantly different from that of TGF-{alpha}/Lepr+Lepr+ and TGF-{alpha}/Lepr+Leprdb mice, P < 0.001 by Newman-Keuls multiple comparison test.

 
Over the course of the 2 years that the mice were monitored, 25 (69%) of 36 of the MMTV–TGF-{alpha}/ Lepr+Lepr+ mice that were necropsied had palpable MTs and/or MTs detected at death, compared with 31 (82%) of 38 of MMTV–TGF-{alpha}/Lepr+Leprdb lean mice (Table 1Go). The remaining lean mice were found dead, and it was not possible to determine their MT status. The average age of MT detection for MMTV–TGF-{alpha}/Lepr+Lepr+ mice was 80 weeks, and that for MMTV–TGF-{alpha}/Lepr+Leprdb mice was 77 weeks. No MTs were detected in obese MMTV–TGF-{alpha}/ LeprdbLeprdb mice (Table 2Go). Thirty-seven percent (16/43) of the MMTV–TGF-{alpha}/LeprdbLeprdb mice were found dead, and the remaining mice were sacrificed prior to age 104 weeks as a consequence of excessive weight loss, open sores, lethargy, and/or breathing difficulties.


View this table:
[in this window]
[in a new window]
 
Table 2. Summary of Histopathology Results of Transgenic MMTV–TGF-{alpha}/Lepr Female Mice
 
As summarized in Table 2Go, of the 94 and 93 MTs obtained from MMTV–TGF-{alpha}/Lepr+Lepr+ and MMTV–TGF-{alpha}/Lepr+Leprdb mice, respectively, the majority were classified as low-grade adenocarcinomas or atypical hyperplasia. The remaining two MTs found in the MMTV–TGF-{alpha}/Lepr+Lepr+ group were high-grade adenocarcinomas, as were the four other MTs found in MMTV–TGF-{alpha}/ Lepr+Leprdb mice. Three putative MTs were removed from MMTV–TGF-{alpha}/LeprdbLeprdb mice, but these were identified as necrotic adipose tissue on histopathological analysis. Additional pathological findings in lean mice included malignancies of the eye, uterus/ovaries and intestine, as well as lymphoma, angiosarcoma, and lymphoproliferative and myeloproliferative disorders. These were not associated with the presence or absence of MTs. Despite the many spontaneous deaths and those necessitated by weight loss and body sores, MMTV–TGF-{alpha}/LeprdbLeprdb mice had few pathological findings to explain their enhanced morbidity and mortality. One obese mouse did have a hepatocellular carcinoma, and two others had signs of pneumonia.

Comparisons were made between MMTV–TGF-{alpha}/ Lepr+Lepr+ and MMTV–TGF-{alpha}/Lepr+Leprdb mice with and without MTs (Tables 3Go and 4Go). Age at death was similar for both lean genotypes, regardless of whether MTs were present (Table 3Go). MTs were also detected at similar ages. Tumor burden, as reflected by MT weight, was 44% greater in MMTV–TGF-{alpha}/Lepr+Leprdb than in MMTV–TGF-{alpha}/ Lepr+Lepr+ mice (P < 0.08), but the number of MTs per mouse was similar (Table 3Go). Forty percent of MMTV–TGF-{alpha}/Lepr+Lepr+ mice had their MTs detected at death, compared with only 20% of MMTV–TGF-{alpha}/Lepr+Leprdb mice. As shown in Table 4Go, there was a significant effect of the presence of MTs on final body weights, but when this was corrected for tumor and organ weights (i.e., carcass weight), there were no significant differences with respect to genotype or the presence of MTs (Table 4Go). There was a significant effect of genotype on fat pad weights, with MMTV–TGF-{alpha}/ Lepr+Leprdb mice having heavier fat pads than those excised from MMTV–TGF-{alpha}/Lepr+Lepr+ lean mice. Similar results were found for fat pad–to–carcass weight calculation (Table 4Go).


View this table:
[in this window]
[in a new window]
 
Table 3. Average Ages of Death and MT Detection and Tumor Number and Weight for Lepr+Lepr+ Versus Lepr+Leprdb Lean Female MMTV–TGF-{alpha} Mice
 

View this table:
[in this window]
[in a new window]
 
Table 4. Final Body and Carcassa Weights, Fat Pad Weight,b and Fat Pad:Carcass Ratio for Lepr+Lepr+ and Lepr+Leprdb Lean MMTV–TGF-{alpha} Female Mice with and Without MTs
 
We examined mammary tissue morphology using whole mammary tissue mounts. Representative whole mounts from MMTV–TGF-{alpha}/Lepr+Lepr+ mice showed abundant ductal branching and the presence of areas of atypical hyperplasia and apparent early MT development (Fig. 3A and BGo). A whole mount from a MMTV–TGF-{alpha}/Lepr+Lepr+ mouse without MTs indicated abundant ductal branching without areas of tumor involvement (Fig. 3CGo). Abundant ductal branching also characterized a whole mount from a non-transgenic Lepr+Lepr+mouse (Fig. 3DGo). Similar results were seen for comparable MMTV–TGF-{alpha}/Lepr+Leprdb and non-transgenic Lepr+Leprdb mice (Fig. 3EGo–H). In contrast, mammary tissue from MMTV–TGF-{alpha}/LeprdbLeprdb mice demonstrated essentially no branching and no sites of atypical hyperplasia or early MT formation (Fig. 3I–KGo). Mammary tissue from a representative nontransgenic LeprdbLeprdb mouse (Fig. 3LGo) displayed a morphology similar to that of MMTV–TGF-{alpha}/LeprdbLeprdb mice.





View larger version (189K):
[in this window]
[in a new window]
 
Figure 3. Mammary-tissue whole mounts from MMTV–transforming growth factor (TGF)–{alpha}/Lepr and nontransgenic Lepr female mice. Thick black arrows, mammary ducts. Open triangle, stromal tissue. White triangle, lymph gland. Thin black triangle nerve fibers. White arrow, tumor tissue. White open star, skeletal muscle/fibers. (A) TGF-{alpha}/Lepr+Lepr+ mouse, age 104 weeks. (B) TGF-{alpha}/Lepr+Lepr+ mouse, age 104 weeks. (C) TGF-{alpha}/Lepr+Lepr+ mouse, age 104 weeks. (D) Nontransgenic Lepr+Lepr+ mouse, age 83 weeks. (E) TGF-{alpha}/Lepr+Leprdb mouse, age 92 weeks. (F) TGF-{alpha}/Lepr+Leprdb mouse, age 93 weeks. (G) TGF-{alpha}/Lepr+Leprdb mouse, age 104 weeks. (H) Nontransgenic Lepr+Leprdb mice, age 73 weeks. (I) TGF-{alpha}/LeprdbLeprdb mouse, age 84 weeks. (J) TGF-{alpha}/LeprdbLeprdb mouse, age 61 weeks. (K) TGF-{alpha}/LeprdbLeprdb mouse. (L) Nontransgenic LeprdbLeprdb mouse, age 86 weeks. Scale bar, 5 mm.

 

    Discussion
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
We report that MMTV–TGF-{alpha}/LeprdbLeprdb mice that are genetically deficient in the long isoform, OB-Rb, of the leptin receptor do not develop oncogene-induced MTs. These findings complement the findings of our earlier study, which indicated that leptin-deficient mice also do not develop oncogene-induced MTs (17). Although MMTV–TGF-{alpha}/ LeprdbLeprdb mice had elevated serum leptin levels, MT development did not occur. In contrast, both lean genotypes developed MTs at incidence rates comparable to our earlier results for MMTV–TGF-{alpha}/Lep strain lean mice (17, 29) and for the originally described MMTV–TGF-{alpha} mice (27). While the present study was under way, it was reported that obese Zucker rats that also have a mutation of the leptin receptor OB-Rb had a decreased incidence of mammary carcinomas after the administration of N-methyl-N-nitrosourea (30). In contrast to the results of most other studies, in which obesity was associated with shortened MT latency, there was no difference in MT latency between obese and lean rats.

One could argue that obesity, in general, and, more specifically, leptin and/or the leptin receptor do not play a role in the development of MMTV–TGF-{alpha}–mediated oncogene-induced tumors. However, leptin receptor–intact MMTV–TGF-{alpha} mice that develop obesity as a result of dietary intervention have significantly shortened MT latency compared with MMTV–TGF-{alpha} mice that remain lean. Furthermore, MTs obtained from MMTV–TGF-{alpha} mice with diet-induced obesity express leptin receptors.

Several epidemiological studies have measured serum leptin levels in women with breast cancer. To date, results directly establishing a role for leptin in human breast carcinogenesis have been inconclusive. One study indicated no association of serum leptin with premenopausal breast cancer (31). However, because obesity is not considered to be a risk factor for premenopausal breast cancer, this result is not surprising. In another study that included both premenopausal and postmenopausal subjects, there also was no relationship shown of leptin with development of breast cancer (32). In a third report, serum leptin levels were significantly higher in women with breast cancer than in control subjects even when body mass index (BMI) was similar (33). In addition, higher serum leptin levels were associated with more advanced disease. Given the relatively newness of the identification of leptin, it is understandable that limited epidemiological data are available.

There are interesting results from in vitro studies that support a role for leptin and leptin receptors in the development of breast cancer. For example, the presence of leptin receptors has been established in several different breast cancer cell lines, and the addition of leptin enhanced cellular proliferation (1922). Also, Hu et al. (19) reported that, although leptin did not stimulate colony formation in a nonmalignant breast epithelial cell line HBL100, T-47D breast cancer cells formed twice as many colonies in the presence of leptin as without. This type of in vitro anchorage-independent growth assay reflects the ability of a cell line to develop tumors when inoculated into athymic mice (34, 35).

It is interesting to note that leptin enhances cell invasion (36, 37) and the migration (38) of other cell types. Furthermore, leptin receptors have been identified in other malignant cell lines and tumors. For example, leptin receptors are expressed in the lung cancer cell line SQ-5 and leptin stimulated proliferation and increased mitogen-activated protein kinase (MAPK) activity in these cells (39). Leptin receptors have been identified in human adrenal tumors (40), pituitary adenomas (41), and stomach tumors (42). In addition, leptin receptors are found in several human leukemia cell lines and in leukemia cells from 50% of patients newly diagnosed with acute myeloid leukemia (43). Of interest, an increased BMI is associated with the risk of leukemia (44). Thus, although leptin receptors were initially identified to be present in the hypothalamus and thought to be part of a feedback mechanism monitoring body fat stores, continued research suggests a more diverse role for this receptor and its ligand.

In many of the studies cited above, it was not specified that the receptor identified was OB-Rb. In our study (19), we used an antibody specific for OB-Rb. The presence of both the long and short isoforms, OB-Rb and Ob-Ra, of the leptin receptor in human breast tumors has been reported, although no association of the isoforms with other tumor characteristics or disease outcome has been shown (20). The relationship of the two isoforms may be of interest, because it has been reported that the coexpression of these two isoforms can generate a mild dominant negative repression of the long (signaling) form of the receptor (45).

The leptin receptor defect in LeprdbLeprdb mice is a mutation that results in defective leptin signaling caused by the absence of a cytoplasmic region of OB-Rb (23, 46, 47). In general, OB-Rb is considered to be the signaling form of the receptor-activating pathways, including JAK/STAT (Janus kinase/signal transducer activation of transcript), MAPK, PI3'K (phosphoinositol 3' kinase), and SOCS-3 (suppressor of cytokine signaling; Refs. 48, 49). The short isoform, OB-Ra, is present in the tissues of LeprdbLeprdb mice (50), but decreased binding of leptin is reported for OB-Ra (51). There has been speculation that signal transduction may occur through OB-Ra (52, 53), but, in general, OB-Rb signaling is considered to be of primary physiological relevance. Evidence for the importance of OB-Rb in signal transduction is supported by the results of a recent gene-transfer study (54). There was no effect of leptin on cell proliferation or signaling in endothelial cells from obese Zucker rats with transfer of the LacZ gene, but, when the OB-Rb gene was transferred, the cells exhibited cell proliferation reaching levels similar to those of lean rats with or without the added gene. In addition, the phosphorylation of STAT3 and JAK2 was detected in cells from obese rats with OB-Rb gene transfection.

With the identification of Lepr and Lep mutations, there was speculation that human obesity could be explained and perhaps treated. However, it appears that very few cases of human obesity result from these defects (55, 56), although genetic variants of the leptin receptor have been identified (5759). In particular, elevated BMI and serum leptin levels have been reported to accompany the Gln223Arg variant (6062). It also has been reported that overfeeding resulted in a greater effect on serum insulin and leptin levels in relation to the Gln223Arg variant in subjects with GlnGln genotype compared with those with GlnArg and ArgArg genotypes (63).

Initially, we chose the Lepr and Lep obesity models because molecular explanations for the genetic defects had been identified and the use of dietary intervention could be avoided. In retrospect, these mice were perhaps not good models of human obesity. However, it is interesting to note that we confirmed a heterozygous effect of the Lepr gene on body fat level (64) and found that heterozygous lean mice weigh more than homozygous lean mice. In addition, we noted that tumor weight was greater in MMTV–TGF-{alpha}/ Lepr+Leprdb than in MMTV–TGF-{alpha}/Lepr+Lepr+ mice and that their incidence of palpable MTs was higher. Although, given the numbers of mice used, these latter differences were not statistically significant, the findings suggest that small changes in body weight and body fat may affect MT development. Specifically, in MMTV-Lepr+Leprdb mice, higher serum leptin levels appear to compensate for the decrease in leptin receptors.

In general, the use the Lepr mouse strain in the present study and in our earlier study using the Lep mouse strain provide important insights in establishing leptin as a potential link between obesity and mammary/breast tumor development. These obese mice that are either leptin deficient or have a defect in the leptin receptor do not develop MTs. In contrast, other rodent models of obesity have shortened tumor latency and/or elevated tumor incidence. Although the general hypothesis of leptin as a growth factor for mammary tumor/breast cancer is still at an early stage, evidence continues to mount that it could be an important determinant factor. We speculate that normal serum leptin levels and a functioning leptin receptor are necessary for normal mammary tissue development. However, elevated serum leptin levels in the presence of functioning receptors or perhaps at a particular ratio of the long to short isoforms may enhance cell signaling and trigger proliferation. Recently, a knock-in mouse model was described whereby tyrosine 1138 of OB-Rb was replaced with serine (65). This change specifically disrupts the STAT3 signaling mediated through OB-Rb. Mice homozygous for this change, s/s, developed obesity and had elevated serum leptin levels, as do LeprdbLeprdb, however, in contrast to LeprdbLeprdb mice, s/s mice are fertile. although they do not lactate. Thus, STAT3 appears to be important in body weight regulation, and possibly for lactation, but not for fertility per se. Continued investigations will delineate the role of leptin and its receptors and signaling pathways in mammary tumorigenesis.


    Acknowledgments
 
We thank Michelle K. Jacobson, Tina L. Jacobson, Susan C. Getzin, and Jessie Freitag for care of the animals. We thank Drs. Pia Roos-Mattjus and Peter Mattjus for transporting biological samples to Rochester, and Dr. Gary Truett for helping us to obtain the original breeding stock of Lepr mice and for sharing the Lepr genotyping assay he developed.


    Footnotes
 
2 Current address: Yale University School of Medicine, New Haven, CT 06520–0958. Back

This research was supported in part by The Hormel Foundation and Grants DAMD17-97-7055, CA79808, and DK16105.

1 Clearly MP, Grande JP, and Maihle NJ, submitted manuscript. Back

2 Hu X, McCleary-Wheeler AL, Juneja SC, Greenwood TM, Grande JP, Maihle NJ, and Cleary MP, manuscript in preparation. Back

Received for publication August 6, 2003. Accepted for publication October 12, 2003.


    References
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Huang Z, Hankinson SE, Colditz GA, Stampfer MJ, Hunter DJ, Manson JE, Hennekens CH, Rosner B, Speizer FE, Willett WC. Dual effects of weight and weight gain on breast cancer risk. JAMA 278:1407–1411, 1997.[Abstract/Free Full Text]
  2. Negri E, La Vecchia C, Bruzzi P, Dardanoni G, Decarli A, Palli D, Parazzini F, Rosselli del Turco M. Risk factors for breast cancer: pooled results from three Italian case-control studies. Am J Epidemiol 128:1207–1215, 1988.[Abstract/Free Full Text]
  3. La Vecchia C, Negri E, Franceschi S, Talamini R, Bruzzi P, Palli D, Decarli A. Body mass index and post-menopausal breast cancer: an age-specific analysis. Br J Cancer 75:441–444, 1997.[Medline]
  4. Cold S, Hansen S, Overvad K, Rose C. A woman’s build and the risk of breast cancer. Eur J Cancer 34:1163–1174, 1998.
  5. Cui Y, Whiteman MK, Langenberg P, Sexton M, Tkaczuk KH, Flaws JA, Bush TL. Can obesity explain the racial difference in stage of breast cancer at diagnosis between black and white women? J Womens Health Gend Based Med 11:527–536, 2002.[Medline]
  6. Cleary MP, Maihle NJ. The role of body mass index in the relative risk of developing premenopausal versus postmenopausal breast cancer. Proc Soc Exp Biol Med 216:28–43, 1997.[Medline]
  7. Johnson KC, Pan S, Mao Y. Risk factors for male breast cancer in Canada, 1994–1998. Eur J Cancer Prev 11:253–263, 2002.[Medline]
  8. Morimoto LM, White E, Chen Z, Chlebowski RT, Hays J, Kuller L, Lopez AM, Manson J, Margolis KL, Muti PC, Stefanick ML, McTiernan A. Obesity, body size, and risk of postmenopausal breast cancer: the Women’s Health Initiative (United States). Cancer Causes Control 13:741–751, 2002.[Medline]
  9. Stephenson GD, Rose DP. Breast cancer and obesity: an update. Nutr Cancer 45:1–16, 2003.[Medline]
  10. Waxler SH, Tabar P, Melcher LP. Obesity and the time of appearance of spontaneous mammary carcinoma in C3H mice. Cancer Res 13:276–278, 1953.
  11. Waxler SH. Obesity and cancer susceptibility in mice. Am J Clin Nutr 8:760–766, 1960.[Abstract]
  12. Seilkop SK. The effect of body weight on tumor incidence and carcinogenicity testing in B6C3F1 mice and F344 rats. Fundam Appl Toxicol 24:247–259, 1995.[Medline]
  13. Haseman JK, Bourbina J, Eustis SL. Effect of individual housing and other experimental design factors on tumor incidence in B6C3F1 mice. Fundam Appl Toxicol 23:44–52, 1994.[Medline]
  14. Wolff GL, Kodell RL, Cameron AM, Medina D. Accelerated appearance of chemically induced mammary carcinomas in obese yellow (Avy/A) (BALB/c XVY) F1 hybrid mice. J Toxicol Environ Health 10:131–142, 1982.[Medline]
  15. Klurfeld DM, Lloyd LM, Welch CB, Davis MJ, Tulp OL, Kritchevsky D. Reduction of enhanced mammary carcinogenesis in LA/N-cp (corpulent) rats by energy restriction. Proc Soc Exp Biol Med 196:381–384, 1991.[Medline]
  16. Heston WE, Vlahakis, G. Genetic obesity and neoplasia. J Natl Cancer Inst 29:197–209, 1962.
  17. Cleary MP, Phillips FC, Getzin SC, Jacobson TL, Jacobson MK, Christensen TA, Juneja SC, Grande JP, Maihle NJ. Genetically obese MMTV–TGF-{alpha}/Lepob Lepob female mice do not develop mammary tumors. Breast Cancer Res Treat 77:205–215, 2003.[Medline]
  18. Zhang Y, Proenca R, Maffei M, Barone M, Leopold L, Friedman JM. Positional cloning of the mouse obese gene and its human homologue. Nature 372:425–432, 1994.[Medline]
  19. Hu X, Juneja SC, Maihle NJ, Cleary MP. Leptin—a growth factor in normal and malignant breast cells and for normal mammary gland development. J Natl Cancer Inst 94:1704–1711, 2002.[Abstract/Free Full Text]
  20. Laud K, Gourdou I, Pessemesse L, Peyrat JP, Djiane J. Identification of leptin receptors in human breast cancer: functional activity in the T47-D breast cancer cell line. Mol Cell Endocrinol 188:219–226, 2002.[Medline]
  21. Dieudonne MN, Machinal-Quelin F, Serazin-Leroy V, Leneveu MC, Pecquery R, Giudicelli Y. Leptin mediates a proliferative response in human MCF7 breast cancer cells. Biochem Biophys Res Commun 293:622–628, 2002.[Medline]
  22. Okumura M, Yamamoto M, Sakuma H, Kojima T, Maruyama T, Jamali M, Cooper DR, Yasuda K. Leptin and high glucose stimulate cell proliferation in MCF-7 human breast cancer cells: reciprocal involvement of PKC-{alpha} and PPAR expression. Biochim Biophys Acta 1592:107–116, 2002.[Medline]
  23. Chen H, Charlat O, Tartaglia LA, Woolf EA, Weng X, Ellis SJ, Lakey ND, Culpepper J, Moore KJ, Breitbart RE, Duyk GM, Tepper RI, Morgenstern JP. Evidence that the diabetes gene encodes the leptin receptor: identification of a mutation in the leptin receptor gene in db/db mice. Cell 84:491–495, 1996.[Medline]
  24. Tritos NA, Mantzoros CS. Leptin: its role in obesity and beyond. Diabetologia 40:1371–1379, 1997.[Medline]
  25. Matsui Y, Halter SA, Holt JT, Hogan BL, Coffey RJ. Development of mammary hyperplasia and neoplasia in MMTV–TGF {alpha} transgenic mice. Cell 61:1147–1155, 1990.[Medline]
  26. Truett GE, Tempelman RJ, Walker JA, Wilson JK. Misty (m) affects growth traits. Am J Physiol 275:R29–R32, 1998.
  27. Halter SA, Dempsey P, Matsui Y, Stokes MK, Graves-Deal R, Hogan BL, Coffey RJ. Distinctive patterns of hyperplasia in transgenic mice with mouse mammary tumor virus transforming growth factor–{alpha}. Characterization of mammary gland and skin proliferations. Am J Pathol 140:1131–1146, 1992.[Abstract]
  28. Sakai S, Mizuno M, Harigaya T, Yamamoto K, Mori T, Coffey RJ, Nagasawa H. Cause of failure of lactation in mouse mammary tumor virus/human transforming growth factor {alpha} transgenic mice. Proc Soc Exp Biol Med 205:236–242, 1994.[Medline]
  29. Cleary MP, Jacobson MK, Phillips FC, Getzin SC, Grande JP, Maihle NJ. Weight-cycling decreases incidence and increases latency of mammary tumors to a greater extent than does chronic caloric restriction in mouse mammary tumor virus–transforming growth factor–{alpha} female mice. Cancer Epidemiol Biomarkers Prev 11:836–843, 2002.[Abstract/Free Full Text]
  30. Lee WM, Lu S, Medline A, Archer MC. Susceptibility of lean and obese Zucker rats to tumorigenesis induced by N-methyl-N-nitrosourea. Cancer Lett 162:155–160, 2001.[Medline]
  31. Mantzoros CS, Bolhke K, Moschos S, Cramer DW. Leptin in relation to carcinoma in situ of the breast: a study of pre-menopausal cases and controls. Int J Cancer 80:523–526, 1999.[Medline]
  32. Petridou E, Papadiamantis Y, Markopoulos C, Spanos E, Dessypris N, Trichopoulos D. Leptin and insulin growth factor I in relation to breast cancer (Greece). Cancer Causes Control 11:383–388, 2000.[Medline]
  33. Tessitore L, Vizio B, Jenkins O, De Stefano I, Ritossa C, Argiles JM, Benedetto C, Mussa A. Leptin expression in colorectal and breast cancer patients. Int J Mol Med 5:421–426, 2000.[Medline]
  34. Li L, Price JE, Fan D, Zhang RD, Bucana CD, Fidler IJ. Correlation of growth capacity of human tumor cells in hard agarose with their in vivo proliferative capacity at specific metastatic sites. J Natl Cancer Inst 81:1406–1412, 1989.[Abstract/Free Full Text]
  35. Price JE. Metastasis from human breast cancer cell lines. Breast Cancer Res Treat 39:93–102, 1996.[Medline]
  36. Attoub S, Noe V, Pirola L, Bruyneel E, Chastre E, Mareel M, Wymann MP, Gespach C. Leptin promotes invasiveness of kidney and colonic epithelial cells via phosphoinositide 3-kinase-, rho-, and rac-dependent signaling pathways. Faseb J 14:2329–2338, 2000.[Abstract/Free Full Text]
  37. Castellucci M, De Matteis R, Meisser A, Cancello R, Monsurro V, Islami D, Sarzani R, Marzioni D, Cinti S, Bischof P. Leptin modulates extracellular matrix molecules and metalloproteinases: possible implications for trophoblast invasion. Mol Hum Reprod 6:951–958, 2000.[Abstract/Free Full Text]
  38. Goetze S, Bungenstock A, Czupalla C, Eilers F, Stawowy P, Kintscher U, Spencer-Hansch C, Graf K, Nurnberg B, Law RE, Fleck E, Grafe M. Leptin induces endothelial cell migration through Akt, which is inhibited by PPAR{gamma}-ligands. Hypertension 40:748–754, 2002.[Abstract/Free Full Text]
  39. Tsuchiya T, Shimizu H, Horie T, Mori M. Expression of leptin receptor in lung: leptin as a growth factor. Eur J Pharmacol 365:273–279, 1999.[Medline]
  40. Glasow A, Bornstein SR, Chrousos GP, Brown JW, Scherbaum WA. Detection of Ob-receptor in human adrenal neoplasms and effect of leptin on adrenal cell proliferation. Horm Metab Res 31:247–251, 1999.[Medline]
  41. Giusti M, Bocca L, Florio T, Corsaro A, Spaziante R, Schettini G, Minuto F. In vitro effect of human recombinant leptin and expression of leptin receptors on growth hormone-secreting human pituitary adenomas. Clin Endocrinol (Oxf) 57:449–455, 2002.[Medline]
  42. Mix H, Widjaja A, Jandl O, Cornberg M, Kaul A, Goke M, Beil W, Kuske M, Brabant G, Manns MP, Wagner S. Expression of leptin and leptin receptor isoforms in the human stomach. Gut 47:481–486, 2000.[Abstract/Free Full Text]
  43. Konopleva M, Mikhail A, Estrov Z, Zhao S, Harris D, Sanchez-Williams G, Kornblau SM, Dong J, Kliche KO, Jiang S, Snodgrass HR, Estey EH, Andreeff M. Expression and function of leptin receptor isoforms in myeloid leukemia and myelodysplastic syndromes: proliferative and anti-apoptotic activities. Blood 93:1668–1676, 1999.[Abstract/Free Full Text]
  44. Estey E, Thall P, Kantarjian H, Pierce S, Kornblau S, Keating M. Association between increased body mass index and a diagnosis of acute promyelocytic leukemia in patients with acute myeloid leukemia. Leukemia 11:1661–1664, 1997.[Medline]
  45. White DW, Kuropatwinski KK, Devos R, Baumann H, Tartaglia LA. Leptin receptor (OB-R) signaling. Cytoplasmic domain mutational analysis and evidence for receptor homo-oligomerization. J Biol Chem 272:4065–4071, 1997.[Abstract/Free Full Text]
  46. Lee GH, Proenca R, Montez JM, Carroll KM, Darvishzadeh JG, Lee JI, Friedman JM. Abnormal splicing of the leptin receptor in diabetic mice. Nature 379:632–635, 1996.[Medline]
  47. Chua SC Jr, Chung WK, Wu-Peng XS, Zhang Y, Liu SM, Tartaglia L, Leibel RL. Phenotypes of mouse diabetes and rat fatty due to mutations in the OB (leptin) receptor. Science 271:994–996, 1996.[Abstract]
  48. Zabeau L, Lavens D, Peelman F, Eyckerman S, Vandekerckhove J, Tavernier J. The ins and outs of leptin receptor activation. FEBS Lett 546:45–50, 2003.[Medline]
  49. Banks AS, Davis SM, Bates SH, Myers MG Jr. Activation of downstream signals by the long form of the leptin receptor. J Biol Chem 275:14563–14572, 2000.[Abstract/Free Full Text]
  50. Ghilardi N, Ziegler S, Wiestner A, Stoffel R, Heim MH, Skoda RC. Defective STAT signaling by the leptin receptor in diabetic mice. Proc Natl Acad Sci U S A 93:6231–6235, 1996.[Abstract/Free Full Text]
  51. Malik KF, Young WS III. Localization of binding sites in the central nervous system for leptin (OB protein) in normal, obese (ob/ob), and diabetic (db/db) C57BL/6J mice. Endocrinology 137:1497–1500, 1996.[Abstract]
  52. Bjorbaek C, Uotani S, da Silva B, Flier JS. Divergent signaling capacities of the long and short isoforms of the leptin receptor. J Biol Chem 272:32686–32695, 1997.[Abstract/Free Full Text]
  53. Murakami T, Yamashita T, Iida M, Kuwajima M, Shima K. A short form of leptin receptor performs signal transduction. Biochem Biophys Res Commun 231:26–29, 1997.[Medline]
  54. Jin X, Fukuda N, Su J, Takagi H, Lai Y, Lin Z, Kanmatsuse K, Wang ZW, Unger RH. Effects of leptin on endothelial function with OB-Rb gene transfer in Zucker fatty rats. Atherosclerosis 169:225–233, 2003.[Medline]
  55. Montague CT, Farooqi IS, Whitehead JP, Soos MA, Rau H, Wareham NJ, Sewter CP, Digby JE, Mohammed SN, Hurst JA, Cheetham CH, Earley AR, Barnett AH, Prins JB, O’Rahilly S. Congenital leptin deficiency is associated with severe early-onset obesity in humans. Nature 387:903–908, 1997.[Medline]
  56. Clement K, Vaisse C, Lahlou N, Cabrol S, Pelloux V, Cassuto D, Gourmelen M, Dina C, Chambaz J, Lacorte JM, Basdevant A, Bougneres P, Lebouc Y, Froguel P, Guy-Grand B. A mutation in the human leptin receptor gene causes obesity and pituitary dysfunction. Nature 392:398–401, 1998.[Medline]
  57. Thompson DB, Ravussin E, Bennett PH, Bogardus C. Structure and sequence variation at the human leptin receptor gene in lean and obese Pima Indians. Hum Mol Genet 6:675–679, 1997.[Abstract/Free Full Text]
  58. Matsuoka N, Ogawa Y, Hosoda K, Matsuda J, Masuzaki H, Miyawaki T, Azuma N, Natsui K, Nishimura H, Yoshimasa Y, Nishi S, Thompson DB, Nakao K. Human leptin receptor gene in obese Japanese subjects: evidence against either obesity-causing mutations or association of sequence variants with obesity. Diabetologia 40:1204–1210, 1997.[Medline]
  59. Gotoda T, Manning BS, Goldstone AP, Imrie H, Evans AL, Strosberg AD, McKeigue PM, Scott J, Aitman TJ. Leptin receptor gene variation and obesity: lack of association in a white British male population. Hum Mol Genet 6:869–876, 1997.[Abstract/Free Full Text]
  60. Mammes O, Aubert R, Betoulle D, Pean F, Herbeth B, Visvikis S, Siest G, Fumeron F. LEPR gene polymorphisms: associations with overweight, fat mass and response to diet in women. Eur J Clin Invest 31:398–404, 2001.[Medline]
  61. Quinton ND, Lee AJ, Ross RJ, Eastell R, Blakemore AI. A single nucleotide polymorphism (SNP) in the leptin receptor is associated with BMI, fat mass and leptin levels in postmenopausal Caucasian women. Hum Genet 108:233–236, 2001.[Medline]
  62. Chagnon YC, Wilmore JH, Borecki IB, Gagnon J, Perusse L, Chagnon M, Collier GR, Leon AS, Skinner JS, Rao DC, Bouchard C. Associations between the leptin receptor gene and adiposity in middle-aged Caucasian males from the HERITAGE family study. J Clin Endocrinol Metab 85:29–34, 2000.[Abstract/Free Full Text]
  63. Ukkola O, Tremblay A, Despres JP, Chagnon YC, Campfield LA, Bouchard C. Leptin receptor Gln223Arg variant is associated with a cluster of metabolic abnormalities in response to long-term overfeeding. J Intern Med 248:435–439, 2000.[Medline]
  64. Chung WK, Belfi K, Chua M, Wiley J, Mackintosh R, Nicolson M, Boozer CN, Leibel RL. Heterozygosity for Lepob or Lepdb affects body composition and leptin homeostasis in adult mice. Am J Physiol 274:R985–R990, 1998.
  65. Bates SH, Stearns WH, Dundon TA, Schubert M, Tso AW, Wang Y, Banks AS, Lavery HJ, Haq AK, Maratos-Flier E, Neel BG, Schwartz MW, Myers MG Jr. STAT3 signalling is required for leptin regulation of energy balance but not reproduction. Nature 421:856–859, 2003.[Medline]



This article has been cited by other articles:


Home page
Molecular Cancer TherapeuticsHome page
D. R. Cochrane, N. S. Spoelstra, E. N. Howe, S. K. Nordeen, and J. K. Richer
MicroRNA-200c mitigates invasiveness and restores sensitivity to microtubule-targeting chemotherapeutic agents
Mol. Cancer Ther., May 1, 2009; 8(5): 1055 - 1066.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
H. Johansson, S. Gandini, A. Guerrieri-Gonzaga, S. Iodice, M. Ruscica, B. Bonanni, M. Gulisano, P. Magni, F. Formelli, and A. Decensi
Effect of Fenretinide and Low-Dose Tamoxifen on Insulin Sensitivity in Premenopausal Women at High Risk for Breast Cancer
Cancer Res., November 15, 2008; 68(22): 9512 - 9518.
[Abstract] [Full Text] [PDF]


Home page
J EndocrinolHome page
C. N Perera, H. G Chin, N. Duru, and I. G Camarillo
Leptin-regulated gene expression in MCF-7 breast cancer cells: mechanistic insights into leptin-regulated mammary tumor growth and progression
J. Endocrinol., November 1, 2008; 199(2): 221 - 233.
[Abstract] [Full Text] [PDF]


Home page
Exp. Biol. Med.Home page
C. N. Perera, H. S. Spalding, S. I. Mohammed, and I. G. Camarillo
Identification of Proteins Secreted from Leptin Stimulated MCF-7 Breast Cancer Cells: A Dual Proteomic Approach
Experimental Biology and Medicine, June 1, 2008; 233(6): 708 - 720.
[Abstract] [Full Text] [PDF]


Home page
Appl. Environ. Microbiol.Home page
L. G. Bermudez-Humaran, S. Nouaille, V. Zilberfarb, G. Corthier, A. Gruss, P. Langella, and T. Issad
Effects of Intranasal Administration of a Leptin-Secreting Lactococcus lactis Recombinant on Food Intake, Body Weight, and Immune Response of Mice
Appl. Envir. Microbiol., August 15, 2007; 73(16): 5300 - 5307.
[Abstract] [Full Text] [PDF]


Home page
Endocr Relat CancerHome page
L. Vona-Davis and D. P Rose
Adipokines as endocrine, paracrine, and autocrine factors in breast cancer risk and progression
Endocr. Relat. Cancer, June 1, 2007; 14(2): 189 - 206.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
N. K. Saxena, P. M. Vertino, F. A. Anania, and D. Sharma
Leptin-induced Growth Stimulation of Breast Cancer Cells Involves Recruitment of Histone Acetyltransferases and Mediator Complex to CYCLIN D1 Promoter via Activation of Stat3
J. Biol. Chem., May 4, 2007; 282(18): 13316 - 13325.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
L. Mauro, S. Catalano, G. Bossi, M. Pellegrino, I. Barone, S. Morales, C. Giordano, V. Bartella, I. Casaburi, and S. Ando
Evidences that Leptin Up-regulates E-Cadherin Expression in Breast Cancer: Effects on Tumor Growth and Progression
Cancer Res., April 1, 2007; 67(7): 3412 - 3421.
[Abstract] [Full Text] [PDF]


Home page
Exp. Biol. Med.Home page
M. P. Cleary, X. Hu, M. E. Grossmann, S. C. Juneja, S. Dogan, J. P. Grande, and N. J. Maihle
Prevention of Mammary Tumorigenesis by Intermittent Caloric Restriction: Does Caloric Intake During Refeeding Modulate the Response?
Experimental Biology and Medicine, January 1, 2007; 232(1): 70 - 80.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
R. R. Gonzalez, S. Cherfils, M. Escobar, J. H. Yoo, C. Carino, A. K. Styer, B. T. Sullivan, H. Sakamoto, A. Olawaiye, T. Serikawa, et al.
Leptin Signaling Promotes the Growth of Mammary Tumors and Increases the Expression of Vascular Endothelial Growth Factor (VEGF) and Its Receptor Type Two (VEGF-R2)
J. Biol. Chem., September 8, 2006; 281(36): 26320 - 26328.
[Abstract] [Full Text] [PDF]


Home page
Clin. Cancer Res.Home page
F. Revillion, M. Charlier, V. Lhotellier, L. Hornez, S. Giard, M.-C. Baranzelli, J. Djiane, and J.-P. Peyrat
Messenger RNA expression of leptin and leptin receptors and their prognostic value in 322 human primary breast cancers.
Clin. Cancer Res., April 1, 2006; 12(7 Pt 1): 2088 - 2094.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF) Free
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Cleary, M. P.
Right arrow Articles by Maihle, N. J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Cleary, M. P.
Right arrow Articles by Maihle, N. J.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS