Experimental Biology and Medicine 232:1458-1464 (2007)
doi: 10.3181/0703-RM-64
© 2007 Society for Experimental Biology and Medicine
ORIGINAL RESEARCH ARTICLE
Nitric Oxide Bioavailability and Not Production Is First Altered During the Onset of Insulin Resistance in Sucrose-Fed Rats
Clemence Blouet1,
François Mariotti,
Veronique Mathe,
Daniel Tome and
Jean-François Huneau2
INRA, AgroParisTech, UMR914 Nutrition Physiology and Ingestive Behavior, Centre de Recherche en Nutrition Humaine–Ile de France, 75005 Paris, France
To whom requests for reprints should be addressed at
2 UMR914 Nutrition Physiology and Ingestive Behavior, AgroParisTech, 16 Rue Claude Bernard, 75005 Paris, France. E-mail: huneau{at}inapg.inra.fr
 |
Abstract
|
|---|
Although the role of nitric oxide (NO) in peripheral glucose uptake has been thoroughly described, little is known regarding the alterations in NO metabolism during the early onset of insulin resistance. During this study we investigated the alterations in NO synthesis and bioavailability in a model for dietary modulations of insulin sensitivity. For 6 weeks, rats were fed a standard diet (C), a high-sucrose diet inducing insulin resistance (HS), or high-sucrose diets supplemented with cysteine, which endowed protection against the high-sucrose–induced insulin resistance (Ti). Several markers of NO synthesis and bioavailability were assessed and confronted with markers of insulin sensitivity. After 5 weeks, although urinary cGMP excretion did not differ between the groups, insulin resistance in HS rats was associated with both a significant increase in NO oxidation, as determined by plasma nitrotyrosine concentrations, and in the inducible NO synthase (iNOS)/endothelial NO synthase (iNOS/eNOS) mRNA ratio in skeletal muscle compared with C rats. These alterations were prevented in rats fed the cysteine-rich diets. NO production, as assessed by urinary 15 NO3– excretion following a [15N2-(guanido)]-arginine intra-venous bolus, independently and significantly correlated with insulin sensitivity but did not significantly differ between C, HS, and Ti rats; neither did the aortic eNOS protein expression or skeletal muscle insulin-induced eNOS activation. Our results indicate that in this model of dietary modulations of insulin sensitivity (i) NO production accounts for part of total inter-individual variation in insulin sensitivity, but (ii) early diet-related changes in insulin sensitivity are accompanied by changes in NO bioavailability.
Key Words: glucose homeostasis nitric oxide insulin resistance oxidative stress dietary cysteine
 |
Introduction
|
|---|
An increasing amount of data suggest that some defects in nitric oxide (NO) signaling concur with the onset of insulin resistance. In healthy subjects, insulin resistance correlates with impaired endothelium-dependent vasodilation (1–3) and, from a metabolic point of view, has been closely associated with lower urinary cGMP excretion, the NO second messenger (4). In agreement with these clinical data, several experimental studies conducted in rodents reported a decrease in NO synthesis and bioavailability under conditions of insulin resistance as a consequence of the decreased ability of insulin to increase endothelial NO release (5, 6), endothelial NO synthase (eNOS) being a downstream protein of the insulin signaling pathway (7, 8). Conversely, targeted disruption of the eNOS gene or acute pharmacologic eNOS blockade cause insulin resistance, reversed by the administration of an NO donor, suggesting that defective NO synthesis may drive the initiation of insulin resistance (9, 10). However, both in humans and in animal models, the alterations in NO metabolism associated with the early stages of insulin resistance are poorly characterized.
Oxidative stress plays an important role in the pathophysiologic alterations of NO signaling, consisting of decreased NO production and/or bioavailability. Indeed, a reduction in NO production has mainly been documented as originating from either the impairment of NOS activity ("NOS uncoupling"; Ref. 11) or increased levels of asymmetric dimethylarginine (ADMA; Refs. 12, 13), a competitive inhibitor of NOS. Both alterations are directly or indirectly related to oxidative stress. A decrease in NO bioavailability is also directly related to oxidative stress because it mainly consists of NO oxidative quenching (14), which generates peroxynitrite, a highly reactive nitrogen species that nitrates protein tyrosine residues. Impairments in NO production and NO bioavailability are interconnected in a vicious cycle, so that in clinical pathologic conditions, many alterations of NO signaling cluster together. However, during the early onset of insulin resistance, it is unclear which component of NO signaling is altered first, although this order is essential if we are to understand the pathophysiologic construct and develop strategies for early prevention.
In a model of diet-induced oxidative stress and insulin resistance (the high-sucrose–fed rat), we previously showed that increasing the dietary cysteine intake, using either a cysteine-rich protein or a cysteine donor, alleviated diet-induced oxidative stress and insulin resistance (15). In the current study, we investigated the alterations of several markers of NO production/bioavailability in this model of early insulin resistance induction/prevention. To directly assess in vivo whole-body NO production, we used an isotopic method to analyze the alterations in NO production per se and distinguish them from those in NO bioavailability.
 |
Materials and Methods
|
|---|
Animals and Diets.
All experiments were carried out in accordance with the guidelines of the French Committee for Animal Care, using 6-week-old male Wistar rats (Harlan, Gannat, France). After a first week of adaptation to the laboratory conditions, the rats (n = 40) were randomly assigned to five groups (C, HS, T1, T2, and T3) and fed the corresponding diets for 6 weeks, as previously described (15). Briefly, the C diet was a standard starch-based laboratory rodent diet, the HS diet was a high-sucrose diet (720 g sucrose per kg food), a model of diet-induced insulin resistance, and the Ti diets were similar high-sucrose diets but were enriched with cysteine—either with a cysteine donor, N-acetylcysteine (T1, 5.8 and T2, 20 g N-acetylcysteine/kg food), or with a cysteine-rich protein (whey protein enriched with
-lactalbumin: T3). The Ti diets were previously shown to be protective against high-sucrose–induced oxidative stress and insulin resistance (15). During Week 4, rats were supplied with nitrate/nitrite-free water (Wattwiller, Wattwiller, France). At Week 5, in vivo NO production was measured. An oral glucose tolerance test was performed at Week 5, and the insulin sensitivity index (OGTT-ISI) was calculated as follows (16): 2 / [(Ins·Gly) +1], with Ins representing the area under the insulin curve above baseline during OGTT and Gly representing the area under the glycemic curve above baseline during OGTT. At Week 6, overnight fasted rats were anesthetized intraperitoneally (sodium pentobarbital, 30 mg/kg body wt), and blood, aorta, and gastrocnemius muscle samples were collected.
Biochemical Analysis.
Unless specified otherwise, all chemicals were obtained from Sigma (La Verpilliere, France). Blood glucose concentrations were measured using a Glucometer (Roche Diagnostics). Commercial assay kits were used to measure insulin (Rat Insulin ELISA; Mercodia, Uppsala, Sweden), ADMA (ADMA ELISA; DLD Diagnostika GmbH, Hamburg, Germany), nitrotyrosine (NWK-NTR01 ELISA, Northwest Life Science, Vancouver, Canada), cGMP (cyclic GMP; Assay Designs, Ann Arbor, MI), nitrate (Nitrate/Nitrite Fluorometric Assay Kit; Cayman Chemical, Ann Arbor, MI) and creatinine (Creatinine; Biomérieux, Marcy lEtoile, France) concentrations.
In Vivo NO Production Measurement.
NO production was measured as the relative recovery of 15N as urinary nitrate following the intravenous administration of [15N2-(guanido)]-arginine, based on the method described by Forte and coworkers (17). Rats were injected with 6.03 mg [15N2-(guanido)]-arginine:HCl per kg body wt on a lateral tail vein and were placed in metabolism cages for the next 14 hrs for the collection of urine samples in glass tubes containing antibiotics, as described by Wu et al. (18). Enrichment of 15N in urinary nitrate was determined by adapting previous methods (17, 19), as previously described in full (20). Briefly, urinary nitrate was extracted on a highly selective ion exchange resin (IMAC-HP-555; Rohm & Haas, Philadelphia, PA) by elution with NaCl (25%) before conversion into ammonia using the microdiffusion method and combustion in an elemental analyzer coupled with an isotope ratio mass spectrometer (MicroMass, Cary, NC). To determine whole-body NO production (17), the amount of 15NO3– recovered from 14-hr urine was calculated, corrected by the excretion of creatinine, and expressed as
of the amount of 15N injected as 15N2-arginine, as follows: (Q x E) / (d x C), where Q and C are the total amounts of nitrate and creatinine excreted in urine, E the 15NO3– enrichment (as atom percent excess) in urine, and d the amount of 15N injected as 15N2-arginine.
Western Blot Analysis.
Skeletal muscle eNOS activation (i.e., insulin-induced eNOS serine 1177 phosphorylation) and aorta eNOS protein expression were determined by Western blot. For the eNOS serine 1177 phosphorylation assay, anesthetized rats received a bolus of insulin (30 µg/kg body wt) into the vena cava. Skeletal muscle fragments were collected 5 mins later and homogenized in ice-cold buffer, and 2 mg total protein was purified using 2',5'-ADP-sepharose (GE Healthcare, Orsay, France). After separation by sodium dodecyl sulfate–polyacrylamide gel eletrophoresis (SDS-PAGE), samples were transferred to nitrocellulose membranes and blotted with anti-phospho eNOS antibody (Ser 1177; Cell Signaling Technology, Danvers, MA). Membranes were stripped and reblotted with anti-eNOS antibodies (Becton Dickinson, Rungis, France). For aorta total eNOS protein concentration measurement, aorta fragments were homogenized in ice-cold buffer, and 100-µg total protein extracts were separated by SDS-PAGE and transferred to membranes. The upper part of the membrane was blotted with anti-eNOS antibody (Becton Dickinson), and the lower part with anti-actin antibody (Santa Cruz Biotechnology, Santa Cruz, CA). Detections were performed after incubation with horse-radish peroxidase–linked secondary antibody, followed by chemiluminescence and quantification using densitometry.
Real Time RT-PCR.
Skeletal muscle eNOS and iNOS gene expression analyses were performed with a Light-Cycler (7300; Applied Biosystem) using SYBR Green I DNA binding dye (Power SYBR Green PCR Master Mix; Applied Biosystems). The following primers were used: eNOS sense, TCCTCAGGAGGTCTTGCACA-TA; eNOS antisense, GCAGCGTGGAGTGTTTGGA; iNOS sense, GAGGAGAGAGATCCGGTTCACA; and iNOS antisense, GCGGGAAGCCATGACCTT. Samples contained 10 µl SYBR Green Master Mix, 600 pmol primers, and 50 ng cDNA in a 20-µl final volume. Ribosomal 18S RNA was used as the internal standard.
Statistical Analysis.
Results are means ± SEM. The diet effect was analyzed with the ANOVA model. Because we focused on the effects of early induction/ prevention of insulin resistance on NO metabolism, multiple comparisons were restricted to only two preplanned comparisons that were performed under the model using orthogonal contrasts: C compared to HS (induction effect), and HS compared to Ti groups taken together (prevention effect). For the same reason, comparisons between Ti groups were not performed, and Ti groups are presented as one single prevention group. Pearson correlations were calculated using the Corr procedure, and multiple linear regressions using the stepwise Reg procedure. The threshold of statistical significance was set at P = 0.05. All statistical analyses were performed using SAS software (SAS for Windows, Version 9.1; Cary, NC).
 |
Results
|
|---|
Insulin Sensitivity.
The consumption of the HS diet for 5 weeks induced insulin resistance, as shown by the significant differences in fasting plasma insulin concentrations and OGTT-ISI in HS rats compared with C rats (Table 1
). Ti diets prevented the high-sucrose–induced insulin resistance.
NO Production and Related Parameters.
NO production, as assessed by urinary 15NO3– excretion after an intravenous administration of 15N-labeled arginine, was not affected by the sucrose diet and remained unchanged in the Ti groups (Table 2
). Plasma ADMA concentrations did not significantly differ between C and HS rats, and HS and Ti rats (Table 2
). After 6 weeks, aortic eNOS protein concentrations did not vary as a function of the diet, nor did eNOS insulin-induced serine 1177 phosphorylation in the skeletal muscle (Fig. 1
).

View larger version (44K):
[in this window]
[in a new window]
|
Figure 1. Endothelial NOS expression and phosphorylation in aorta and skeletal muscle of rats fed the C, HS, and Ti diets for 6 weeks. (A) Proteins from thoracic aorta homogenates were size fractionated by SDS-PAGE and immunoblotted for total eNOS and β-actin. (B) Rats were injected with insulin (30 µg/kg), and eNOS was affinity purified from gastrocnemius homogenates using 2'-5'-ADP-sephar-ose. Proteins were size fractionated by SDS-PAGE and immunoblotted with antibodies to eNOS or Ser1177-phospho-eNOS. Ratio of empirical densitometric units are shown on the bottom of each gel. Mean ± SEM of n = 5 rats (A) and n = 3 to 4 rats (B).
|
|
NO Bioavailability.
Figure 2
shows the effects of the experimental diets on parameters related to NO bioavailability. Plasma nitrotyrosine concentrations were significantly lower in C rats than in HS rats, and lower in Ti than in HS rats (Fig. 2A
). The skeletal muscle ratio of iNOS to eNOS mRNA concentrations, considered as an tentative explicatory marker of alterations in NO bioavailability (21, 22), was significantly higher in HS rats than in C rats, but it did not differ between Ti and C rats, and Ti and HS rats (Fig. 2B
). However, urinary cGMP excretion did not differ significantly between groups (0.32 ± 0.06, 0.35 ± 0.04, and 0.36 ± 0.1 pmol/mmol creatinine in C, HS, and Ti rats, respectively).

View larger version (16K):
[in this window]
[in a new window]
|
Figure 2. Plasma nitrotyrosine concentrations (A) and skeletal muscle iNOS/eNOS mRNA ratio (B) in rats fed the C, HS, and Ti diets for 6 weeks. Data are means ± SEM, n = 7 to 8 or n = 5 for mRNA data. *P < 0.05.
|
|
Correlations Between Insulin Sensitivity and NO Production/Bioavailability.
Figure 3
presents the most relevant and significant Pearson correlations obtained using the SAS Corr procedure. NO production was positively correlated with OGTT-ISI (r = 0.52, P < 0.01) and negatively correlated with fasting plasma insulin concentrations (r =–0.36, P = 0.05). When the variables were analyzed using stepwise multiple regressions, only urinary 15NO3– excretion and iNOS/eNOS muscle mRNA ratio were independently and significantly correlated with OGTT-ISI (P < 0.001 and P < 0.01, respectively; Table 3
).

View larger version (9K):
[in this window]
[in a new window]
|
Figure 3. Pearson correlations between NO production ( 15N recovered as urinary nitrate after [15N2-(guanido)]-arginine intravenous bolus/mmol creatinine; n = 7 to 8), skeletal muscle iNOS/ eNOS mRNA ratio (n = 6), OGTT-ISI (n = 7 to 8), and fasting plasma insulin (n = 7 to 8).
|
|
View this table:
[in this window]
[in a new window]
|
Table 3. Stepwise Multiple Regression for Insulin Sensitivity Index, As Determined During the Oral Glucose Tolerance Testa
|
|
 |
Discussion
|
|---|
Using rats fed a high-sucrose diet for 6 weeks as a model for the early induction of insulin resistance and cysteine donors as effective preventive agents, we showed that (i) NO production could explain part of the total variation of insulin sensitivity in rats, but (ii) decreased NO bioavailability was the main impairment in NO metabolism that came along with the initiation of insulin resistance.
Consumption of the HS diet for 5 weeks significantly increased plasma nitrotyrosine concentrations, a stable footprint of NO oxidation. This result indicated a decrease in NO bioavailability in HS-fed rats, even though urinary cGMP excretion did not vary as a function of the diet (this invariance did not preclude local differences in cGMP levels that we could not assess from measurements of whole-body cGMP production). Interestingly, this decreased NO bioavailabitity was associated with an increase in the skeletal muscle iNOS/eNOS mRNA ratio. Although this result was not confirmed by measuring the iNOS/eNOS protein expression ratio, an increased iNOS/eNOS mRNA ratio indicates the initiation of an imbalance in the type of NO production in HS rats that might contribute to a reduction in NO bioavailability. Indeed, an imbalance in the fine tuning between eNOS and iNOS pathways in favor of the latter has been incriminated in the initiation of numerous pathologic conditions, including insulin resistance (21, 22), partly by favoring the oxidative degradation of NO to peroxynitrite (23). In the context of the high-sucrose diet, higher production of superoxide anion is very likely to account for the increase in NO scavenging and the resulting production of peroxynitrite. Possible underlying mechanisms include upregulation of NAD(P)H oxidase and/or downregulation of superoxide dismutase, as already reported in similar models of diet-induced oxidative stress (24–27).
The HS diet did not affect aortic eNOS protein levels and insulin-induced eNOS activation, which is in line with the findings of a study that measured no change in eNOS expression and phosphorylation in rats fed a high-fructose diet for 8 weeks (28). In addition, the HS diet did not affect NO production and plasma ADMA concentrations, the values measured in HS rats being remarkably similar to those measured in rats receiving the C diet. This result apparently contrasts with what had previously been reported under conditions of oxidative stress and with other models of diet-induced oxidative stress in rodents. Indeed, oxidative stress has been reported to be associated with tetrahydrobiopterin deficiency and/or to elevated plasma ADMA, both leading to a reduction in NO production (11, 29). In rats fed a high-refined sugar and/or high-fat diet, an impairment of endothelial-dependant vasodilation was associated with a decrease in eNOS expression, NO production and bioavailability, and reduced insulin-induced eNOS activation (30). However, in the latter studies, these observations were made after more than 4 months of treatment. Similarly, an increase in plasma ADMA and an apparent decrease in NO production have mostly been demonstrated in a setting of pathologic conditions or in at-risk subjects who already displayed a cluster of risk factors, such as those associated with the metabolic syndrome (13). Therefore, based on the present pathophysiologic model (rats fed an HS diet for 6 weeks), we propose that a decrease in NO bioavailability is the first impairment that affects NO metabolism in the course of insulin resistance, and that subsequent impairment in NO metabolism lags behind.
The important role played by the impairment of NO bioavailability in this pathophysiologic process is further demonstrated by the observation that the prevention of insulin resistance observed with cysteine-rich diets was associated with a significant reduction in plasma nitrotyrosine levels, resulting in partial normalization of this marker. Although the skeletal muscle iNOS/eNOS mRNA ratio in rats fed cysteine-rich diets did not differ from that of HS rats, an observation that could be related to a lack of statistical power, this variable was significantly correlated with plasma nitrotyrosine values (r = 0.46, P < 0.05), suggesting that the imbalance in the type of NO production was partly prevented by cysteine supplementation.
As far as the preventive effect of dietary cysteine is concerned, our results may also be helpful in inferring any underlying mechanism. Because we have previously shown that providing the cysteine-rich diets prevented the oxidation of tissue GSH/GSSG redox potential resulting from high-sucrose feeding (15), we propose that the positive impact of the cysteine-rich diets on NO bioavailability is mediated by the maintenance of the body redox status. Increased glutathione synthesis, as reported after a similar increase in dietary sulfur amino acid intake (31), could favor the formation of S-nitrosothiol, a stable adduct of nitric oxide and glutathione that protects nitric oxide from oxidative destruction (32, 33). Previous studies already reported the beneficial effects of N-acetylcysteine supplementation on oxidative stress, glycemic control, and NO production/bioavailability over the short term in streptozotocin-induced diabetic rats (34, 35). However, in the present study, these effects were investigated at the very beginning of the onset of insulin resistance, and the effects of N-acetylcysteine supplementation were duplicated by the consumption of a cysteine-rich protein, an original finding. It is not excluded that the response to the three different Ti treatments could display some heterogeneity, suggesting possible different underlying mechanisms. Indeed, according to the multiple regression analysis, changes in NO bioavailability account only for 25% of changes in insulin sensitivity. However, we found no significant effect of the type of cysteine supplementation within the Ti group regarding insulin sensitivity and NO-related parameters.
Lastly, in order to gain further insight into the relative importance of NO production versus NO bioavailability in explaining the total variation of insulin sensitivity in our experimental setting, we analyzed the correlations between NO-related markers and insulin sensitivity. The results confirmed the importance of NO bioavailability, the muscle iNOS/eNOS mRNA ratio being negatively correlated with OGTT-ISI. However, we also found that NO production significantly explained part of the total variance in both fasting plasma insulin and OGTT-ISI (i.e., both the basal and dynamic indicators of insulin sensitivity). A multiple regression analysis revealed that NO production was the first predictor of OGTT-ISI. Therefore, our data show that NO production was the most important contributor to insulin sensitivity within the groups, despite the lack of difference in NO production between groups. Recently, polymorphisms in the promoter and coding regions of the eNOS gene have been reported to affect NO production and insulin sensitivity in humans (36–38). Whether such polymorphisms exist in outbred rats and could account for the differences in NO production and insulin sensitivity remains to be demonstrated.
Taken together, our data strongly suggest that in our animal model, (i) NO production is a major inherited factor of insulin sensitivity, whereas (ii) a decrease in NO bioavailability by NO oxidative scavenging is the first hit in the induction of insulin resistance. Other impairments to NO metabolism, which cluster together in a vicious cycle, may occur later during the progression of insulin resistance. Further studies are required to gain further insights on the importance of early defects in NO bioavailability to the initiation of insulin resistance.
 |
Footnotes
|
|---|
C.L. was supported by a Ministere de la Recherche et de la Technologie grant from the French Ministry for Research.
1 Current address: Department of Medicine, Diabetes Research Center, Albert Einstein College of Medicine, Bronx, NY 10461. 
Received for publication March 12, 2007.
Accepted for publication August 1, 2007.
 |
References
|
|---|
- Goldfine AB, Beckman JA, Betensky RA, Devlin H, Hurley S, Varo N, Schonbeck U, Patti ME, Creager MA. Family history of diabetes is a major determinant of endothelial function. J Am Coll Cardiol 47:2456–2461, 2006.[Abstract/Free Full Text]
- McSorley PT, Bell PM, Young IS, Atkinson AB, Sheridan B, Fee JP, McCance DR. Endothelial function, insulin action and cardiovascular risk factors in young healthy adult offspring of parents with Type 2 diabetes: effect of vitamin E in a randomized double-blind, controlled clinical trial. Diabet Med 22:703–710, 2005.[CrossRef][Medline]
- Petrie JR, Ueda S, Webb DJ, Elliott HL, Connell JM. Endothelial nitric oxide production and insulin sensitivity. A physiological link with implications for pathogenesis of cardiovascular disease. Circulation 93: 1331–1333, 1996.[Abstract/Free Full Text]
- Cui R, Iso H, Pi J, Kumagai Y, Yamagishi K, Tanigawa T, Shimamoto T. Metabolic syndrome and urinary cGMP excretion in general population. Atherosclerosis 190:423–428, 2006.[Medline]
- Kuboki K, Jiang ZY, Takahara N, Ha SW, Igarashi M, Yamauchi T, Feener EP, Herbert TP, Rhodes CJ, King GL. Regulation of endothelial constitutive nitric oxide synthase gene expression in endothelial cells and in vivo: a specific vascular action of insulin. Circulation 101:676–681, 2000.[Abstract/Free Full Text]
- Naruse K, Rask-Madsen C, Takahara N, Ha SW, Suzuma K, Way KJ, Jacobs JR, Clermont AC, Ueki K, Ohshiro Y, Zhang J, Goldfine AB, King GL. Activation of vascular protein kinase C-beta inhibits Akt-dependent endothelial nitric oxide synthase function in obesity-associated insulin resistance. Diabetes 55:691–698, 2006.[Abstract/Free Full Text]
- Fontana J, Fulton D, Chen Y, Fairchild TA, McCabe TJ, Fujita N, Tsuruo T, Sessa WC. Domain mapping studies reveal that the M domain of hsp90 serves as a molecular scaffold to regulate Akt-dependent phosphorylation of endothelial nitric oxide synthase and NO release. Circ Res 90:866–873, 2002.[Abstract/Free Full Text]
- Kim JA, Montagnani M, Koh KK, Quon MJ. Reciprocal relationships between insulin resistance and endothelial dysfunction: molecular and pathophysiological mechanisms. Circulation 113:1888–1904, 2006.[Abstract/Free Full Text]
- Duplain H, Burcelin R, Sartori C, Cook S, Egli M, Lepori M, Vollenweider P, Pedrazzini T, Nicod P, Thorens B, Scherrer U. Insulin resistance, hyperlipidemia, and hypertension in mice lacking endothelial nitric oxide synthase. Circulation 104:342–345, 2001.[Abstract/Free Full Text]
- Guarino MP, Correia NC, Lautt WW, Macedo MP. Insulin sensitivity is mediated by the activation of the ACh/NO/cGMP pathway in rat liver. Am J Physiol Gastrointest Liver Physiol 287:G527–G532, 2004.[Abstract/Free Full Text]
- Channon KM. Tetrahydrobiopterin: regulator of endothelial nitric oxide synthase in vascular disease. Trends Cardiovasc Med 14:323–327, 2004.[CrossRef][Medline]
- Stuhlinger MC, Abbasi F, Chu JW, Lamendola C, McLaughlin TL, Cooke JP, Reaven GM, Tsao PS. Relationship between insulin resistance and an endogenous nitric oxide synthase inhibitor. JAMA 287:1420–1426, 2002.[Abstract/Free Full Text]
- Sydow K, Mondon CE, Cooke JP. Insulin resistance: potential role of the endogenous nitric oxide synthase inhibitor ADMA. Vasc Med 10(Suppl 1):S35–S43, 2005.[Abstract/Free Full Text]
- Guzik TJ, Mussa S, Gastaldi D, Sadowski J, Ratnatunga C, Pillai R, Channon KM. Mechanisms of increased vascular superoxide production in human diabetes mellitus: role of NAD(P)H oxidase and endothelial nitric oxide synthase. Circulation 105:1656–1662, 2002.[Abstract/Free Full Text]
- Blouet C, Mariotti F, Azzout-Marniche D, Mathe V, Mikogami T, Tome D, Huneau JF. Dietary cysteine alleviates sucrose-induced oxidative stress and insulin resistance. Free Radic Biol Med 42:1089–1097, 2007.[CrossRef][Medline]
- Belfiore F, Iannello S, Volpicelli G. Insulin sensitivity indices calculated from basal and OGTT-induced insulin, glucose, and FFA levels. Mol Genet Metab 63:134–141, 1998.[CrossRef][Medline]
- Forte P, Copland M, Smith LM, Milne E, Sutherland J, Benjamin N. Basal nitric oxide synthesis in essential hypertension. Lancet 349:837–842, 1997.[CrossRef][Medline]
- Wu G, Flynn NE, Flynn SP, Jolly CA, Davis PK. Dietary protein or arginine deficiency impairs constitutive and inducible nitric oxide synthesis by young rats. J Nutr 129:1347–1354, 1999.[Abstract/Free Full Text]
- Herman F, Smidt S, Englisch M, Feichtinger F, Gerzabek M, Haberhauer G, Jandl R, Kalina M, Zechmeister-Boltenstern S. Investigations of nitrogen fluxes and pools on a limestone site in the Alps. Environ Sci Pollut Res Int Spec No 2:46–52, 2002.
- Mariotti F, Huneau JF, Szezepanski I, Petzke KJ, Aggoun Y, Tome D, Bonnet D. Meal amino acids with varied levels of arginine do not affect postprandial vascular endothelial function in healthy young men. J Nutr 137:1383–1389, 2007.[Abstract/Free Full Text]
- Carvalho-Filho MA, Ueno M, Carvalheira JB, Velloso LA, Saad MJ. Targeted disruption of iNOS prevents LPS-induced S-nitrosation of IRbeta/IRS-1 and Akt and insulin resistance in muscle of mice. Am J Physiol Endocrinol Metab 291:E476–E482, 2006.[Abstract/Free Full Text]
- Perreault M, Marette A. Targeted disruption of inducible nitric oxide synthase protects against obesity-linked insulin resistance in muscle. Nat Med 7:1138–1143, 2001.[CrossRef][Medline]
- Esch T, Stefano GB, Fricchione GL, Benson H. Stress-related diseases—a potential role for nitric oxide. Med Sci Monit 8:RA103–RA118, 2002.[Medline]
- Busserolles J, Rock E, Gueux E, Mazur A, Grolier P, Rayssiguier Y. Short-term consumption of a high-sucrose diet has a pro-oxidant effect in. Br J Nutr 87:337–342, 2002.[CrossRef][Medline]
- Busserolles J, Zimowska W, Rock E, Rayssiguier Y, Mazur A. Rats fed a high sucrose diet have altered heart antioxidant enzyme. Life Sci 71: 1303–1312, 2002.[Medline]
- Delbosc S, Paizanis E, Magous R, Araiz C, Dimo T, Cristol J, Cros G, Azay J. Involvement of oxidative stress and NADPH oxidase activation in the. Atherosclerosis 179:43–49, 2005.[CrossRef][Medline]
- Roberts CK, Barnard RJ, Sindhu RK, Jurczak M, Ehdaie A, Vaziri ND. Oxidative stress and dysregulation of NAD(P)H oxidase and antioxidant enzymes in diet-induced metabolic syndrome. Metabolism 55:928–934, 2006.[CrossRef][Medline]
- Fulton D, Harris MB, Kemp BE, Venema RC, Marrero MB, Stepp DW. Insulin resistance does not diminish eNOS expression, phosphorylation, or binding to HSP-90. Am J Physiol Heart Circ Physiol 287: H2384–H2393, 2004.[Abstract/Free Full Text]
- Sydow K, Munzel T. ADMA and oxidative stress. Atheroscler (Suppl 4): 41–51, 2003.
- Roberts CK, Barnard RJ, Sindhu RK, Jurczak M, Ehdaie A, Vaziri ND. A high-fat, refined-carbohydrate diet induces endothelial dysfunction and oxidant/antioxidant imbalance and depresses NOS protein expression. J Appl Physiol 98:203–210, 2005.[Abstract/Free Full Text]
- Morand C, Rios L, Moundras C, Besson C, Remesy C, Demigne C. Influence of methionine availability on glutathione synthesis and delivery by the liver. J Nutr Biochem 8:246–255, 1997.
- Jourdheuil D, Hallen K, Feelisch M, Grisham MB. Dynamic state of S-nitrosothiols in human plasma and whole blood. Free Radic Biol Med 28:409–417, 2000.[CrossRef][Medline]
- Prasad A, Andrews NP, Padder FA, Husain M, Quyyumi AA. Glutathione reverses endothelial dysfunction and improves nitric oxide bioavailability. J Am Coll Cardiol 34:507–514, 1999.[Abstract/Free Full Text]
- Nagareddy PR, Xia Z, MacLeod KM, McNeill JH. N-acetylcysteine prevents nitrosative stress-associated depression of blood pressure and heart rate in streptozotocin diabetic rats. J Cardiovasc Pharmacol 47: 513–520, 2006.[Medline]
- Xia Z, Nagareddy PR, Guo Z, Zhang W, McNeill JH. Antioxidant N-acetylcysteine restores systemic nitric oxide availability and corrects depressions in arterial blood pressure and heart rate in diabetic rats. Free Radic Res 40:175–184, 2006.[CrossRef][Medline]
- Monti LD, Barlassina C, Citterio L, Galluccio E, Berzuini C, Setola E, Valsecchi G, Lucotti P, Pozza G, Bernardinelli L, Casari G, Piatti P. Endothelial nitric oxide synthase polymorphisms are associated with type 2 diabetes and the insulin resistance syndrome. Diabetes 52:1270–1275, 2003.[Abstract/Free Full Text]
- Ohtoshi K, Yamasaki Y, Gorogawa S, Hayaishi-Okano R, Node K, Matsuhisa M, Kajimoto Y, Hori M. Association of (-)786T-C mutation of endothelial nitric oxide synthase gene with insulin resistance. Diabetologia 45:1594–1601, 2002.[CrossRef][Medline]
- Tso AW, Tan KC, Wat NM, Janus ED, Lam TH, Lam KSL. Endothelial nitric oxide synthase G894T (Glu298Asp) polymorphism was predictive of glycemic status in a 5-year prospective study of Chinese subjects with impaired glucose tolerance. Metabolism 55: 1155–1158, 2006.[Medline]