EBM Email Content Delivery
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
QUICK SEARCH:   [advanced]


     

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Takabayashi, S.
Right arrow Articles by Katoh, H.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Takabayashi, S.
Right arrow Articles by Katoh, H.
Experimental Biology and Medicine 232:695-699 (2007)
© 2007 Society for Experimental Biology and Medicine

ORIGINAL RESEARCH ARTICLE

The Novel Tetratricopeptide Repeat Domain 7 Mutation, Ttc7fsn-Jic, with Deletion of the TPR-2B Repeat Causes Severe Flaky Skin Phenotype

Shuji Takabayashi*, Shuichi Iwashita{dagger}, Tsukasa Hirashima{dagger} and Hideki Katoh*,{ddagger},1

* Institute for Experimental Animals, Hamamatsu University School of Medicine, Hamamatsu, Shizuoka 431-3192, Japan; {dagger} Otsuka GEN Research Institute, Otsuka Pharmaceutical Co. Ltd., Tokushima, Tokushima 771-0192, Japan; and {ddagger} Central Institute for Experimental Animals, Kawasaki, Kanagawa 216-0002, Japan

1To whom requests for reprints should be addressed at Institute for Experimental Animals, Hamamatsu Univeristy School of Medicine, 1-20-1 Handayama, Hamamatsu, Shizuoka 431-3192, Japan. E-mail: hideki-k{at}hama-med.ac.jp or hhidekik{at}yahoo.co.jp


   Abstract
Top
 Abstract
Introduction
 Materials and Methods
 Results
 Discussion
 References
 
We carried out molecular analyses of the novel flaky skin mutation, Ttc7fsn-Jic (a synonym for fsnJic), which we found in a previous study. It was revealed that this mutation involved a genomic in-frame deletion including exons 9 and 10 of the Ttc7 gene, and that the genomic deletion in Ttc7 fsn-Jic may disrupt the tetratricopeptide repeat-2B domain of the TTC7 protein. Based on a comparison of three Ttc7 mutations, including Ttc7fsn-J (a synonym for fsn) and Ttc7fsn-hea (a synonym for hea), it was suggested that either exon 9 or exon 10 or both may play a more important role than the other exons of the Ttc7 gene. Ttc7 gene expression analyses using Northern blotting revealed that Ttc7 mRNA is expressed in 11 tissues, except muscle. In conclusion, we confirmed that the Ttc7 fsn-Jic mutation, as well as the Ttc7fsn-J and Ttc7 fsn-hea mutations, is responsible for abnormal phenotypes observed in various tissues of mice with the flaky skin mutation.

Key Words: flaky skin • psoriasis • fsn • Ttc7 • TPR • exon deletion


   Introduction
Top
 Abstract
 Introduction
Materials and Methods
 Results
 Discussion
 References
 
Flaky skin ( fsn) mice are used as an animal model of human psoriasis because they develop thick scales with associated patchy alopecia (1, 2). So far, three flaky skin mutants have been reported. The fsn mutation (hereafter referred to as Ttc7fsn-J) arose spontaneously in A/J mice (3), and during study of this mutant the fsn locus was assigned to chromosome 17 (3, 4). The hea mutant (hereafter referred to as Ttc7fsn-hea) was reported by Shimizu et al. (5) and White et al. (6), and fsnJic (hereafter referred to as Ttc7fsn-Jic) was reported by us (7). Recently, it was demonstrated that the Ttc7fsn-J mutation is caused by the insertion of an ETn transposon (8, 9), and that the Ttc7fsn-hea mutation is caused by a large deletion of exons 1–14 of 20 exons (8).

It is well known that flaky skin mice have a pleiotropic disease phenotype, with such features as a smaller body; anemia; low iron metabolism; low hematocrit; enlargement of the liver, spleen, and heart; increased nucleated red blood cells; fragile erythrocyte membranes; and lymphocyte infiltration in the liver and kidneys (3, 10–14). Studies using Ttc7fsn-J mice have focused on immunologic dysfunction (10, 11, 14, 15) and autoimmunity (16–23). As a result, it has been recognized that the TTC7 protein may be an important regulator of lymphocyte development and function.

Different life spans of three Ttc7 congenic mice with the BALB/c genetic background have been found. Ttc7fsn-hea homozygotes have the shortest life span (about 7 days; Ref. 6), and Ttc7fsn-Jic homozygotes live about 10 days (7). In contrast, the life span of the Ttc7fsn-J homozygotes is about 3 months. This phenomenon suggests that these three mutant alleles are generated by different mutations.

In the present study we attempted a mutation search of the novel mutation, Ttc7fsn-Jic, in order to identify differences between it and the other Ttc7 mutations. We also carried out expression studies in 12 tissues using Northern blotting.


   Materials and Methods
Top
 Abstract
 Introduction
 Materials and Methods
Results
 Discussion
 References
 
Mice and Genetic Nomenclature.
The B6.INT-Ttc7fsn-Jic mice maintained in our laboratory were used in this study. The flaky skin phenotypes of the mice are described elsewhere (7). CBy.A-Ttc7fsn-J was purchased from the Jackson Laboratory (Bar Harbor, ME). C57BL/6JJcl mice were purchased from CLEA Japan (Tokyo, Japan) and were used as the normal mice in this study.

In accordance with information in the Mouse Genome Informatics Database (http://www.informatics.jax. org/mgihome/nomen/), the following gene symbols are used in this paper: Ttc7fsn-J for fsnJ, Ttc7fsn-hea for fsnhea, and Ttc7fsn-Jic for fsnJic.

Mutation Search.
Extraction of Genomic DNA and Messenger RNA.
Genomic DNA was extracted using the standard method. Extraction of messenger RNA was performed using Trizol reagent (Invitrogen, Carlsbad, CA) in accordance with the manufacturer’s instruction.

Genomic Polymerase Chain Reaction (PCR) and Reverse Transcriptase (RT)-PCR.
Genomic PCR was performed to amplify the Ttc7 exons. The primer sets derived from flanking sequences 50 bp upstream and downstream of Ttc7 are shown in Table 1Go. Conditions for genomic PCR were: 35 cycles of 30 secs at 94°C, 30 secs at 60°C, and 30 secs at 72°C, using Ex-Taq polymerase (TaKaRa, Kyoto, Japan) in accordance with the manufacturer’s instruction. Two-percent agarose gels (Nippon Gene, Tokyo, Japan) were used as analytical gels and were prepared in Tris-acetate-EDTA buffer.


View this table:
[in this window]
[in a new window]

  		Table 1. Primer Sets Used for Genomic PCR (5'-3')a
 
RT-PCR was carried out using a Superscript III First-Strand cDNA synthesis kit (Invitrogen) in accordance with the manufacturer’s instruction. Agarose gels (0.8% and 2%) were used as described above.

Sequencing.
To perform direct sequencing, the PCR products were purified using a MinElute PCR purification kit (Qiagen, Valencia, CA). Sequencing was carried out using an ABI3700 automated sequencer (Applied Biosystems, Foster City, CA). Analyses of sequence data were carried out using Sequencher software (Gene Codes, Ann Arbor, MI).

Northern Blotting.
The cDNA probe (approximately 0.46 kb and including exons 17–20) for Northern blotting was prepared using RT-PCR. Purification of the cDNA was carried out using Quiaquick Gel Extraction Kit (Qiagen) and labeled with 32P-2'-deoxycytidine 5'-triphosphate (32P-dCTP) using a Prime-It Labeling kit (STRATAGENE; Roche Molecular Biochemicals, Mannheim, Germany) in accordance with the manufacturer’s instructions. Northern blot membrane was purchased from OriGene Technologies (Rockville, MD).


   Results
Top
 Abstract
 Introduction
 Materials and Methods
 Results
Discussion
 References
 
Identification of the Ttc7fsn-Jic.
Genomic PCR was performed using 20 primer sets designed to detect 20 exons of the Ttc7 gene. As shown in Figure 1Go, exons 9 and 10 were not detected in the Ttc7fsn-Jic mutation.


Figure 1
View larger version (35K):
[in this window]
[in a new window]

  		Figure 1. Exon deletion in the Ttc7fsn-Jic mutation. Using genomic PCR, exons 1–20 were detected in the normal mice (+), but exons 9 and 10 were not detected in the mutant mice (Ttc7fsn-Jic). M indicates the {varphi}X174 phage DNA digested with HaeIII enzyme.

 
RT-PCR also was carried out to confirm the deletion. As shown in Figure 2Go, two mutation bands were indicated by gel electrophoresis. One is a 786-bp band deleting 222 bp, which is equivalent to 74 amino acids, including exons 9 and 10, and the other is a 681-bp band deleting 327 bp, which is equivalent to 109 amino acids, including exons 9–11. Genomic DNA sequencing was performed to clarify the reason why two different deletions were present. As a result, a 10-base deletion from –32 to –41 of the 5' sequence near exon 11 was observed, as shown in Figure 3Go.


Figure 2
View larger version (27K):
[in this window]
[in a new window]

  		Figure 2. Two types of deletion mutation in the Ttc7fsn-Jic mutation. Primers TCACCTCTACGAAGGGGACAA (forward) and AGAGT-CAGGTGGATACCGTT (reverse) that were designed based on sequence data in the National Center for Biotechnology Information (NCBI) database (http://www.ncbi.nih.gov/) were used to amplify 1008 bp, including exons 7–17. RT-PCR using this primer pair amplified two different PCR products, 681 bp and 786 bp, from the Ttc7fsn-Jic mutation. Ttc7+ and Ttc7fsn-J were clearly identified by the different sizes of their PCR products (1008 bp and 1191 bp, respectively). M indicates the {varphi}X174 phage DNA digested with HaeIII enzyme.

 

Figure 3
View larger version (13K):
[in this window]
[in a new window]

  		Figure 3. A 10-base deletion exists in intron 10 near exon 11 of Ttc7fsn-Jic. The PCR product used for sequencing was amplified using the primers designed in intron 10 and intron 11. Rectangles shown the 10 bases from –41 to –32 at the 5' end near exon 11.

 
Expression Studies of Ttc7 mRNA.
We studied expression of the Ttc7 gene in 12 tissues of the normal mouse. As shown in Figure 4Go, Ttc7 mRNA was strongly expressed in kidney and liver; was moderately expressed in the skin, spleen, stomach, intestine, thymus, and lung; was weakly expressed in the brain, heart, and testis; and was absent in muscle.


Figure 4
View larger version (54K):
[in this window]
[in a new window]

  		Figure 4. Ttc7 mRNA expression using Northern blotting. The cDNA probe for Northern blotting was prepared using RT-PCR with the primers 5'-GAAGAAACAGAACGGTATCCAC-3' (forward) and 5'-TCCACAGCATCCCGCAGCACCT-3' (reverse), which were designed based on sequence data in the NCBI database (http://www.ncbi.nih.gov/). A high-density band in a small size was observed in testis. This band also was observed by Helms et al. (9).

 
Comparison of Genomic DNA and mRNA of Ttc7fsn-Jic, Ttc7fsn-hea, and Ttc7fsn-J.
Possible structures of genomic DNA and mRNA of the Ttc7+, Ttc7fsn-Jic, Ttc7fsn-hea, and Ttc7fsn-J mutations are shown in Figure 5Go. As a result of comparing these structures, it was supposed that the deletion of exons 9 and 10 in the Ttc7fsn-Jic mutation leads to a lack of tetratricopeptide repeat-2B (TPR-2; Fig. 5fGo), and that the deletion of exons 1–14 in the Ttc7fsn-hea mutation leads to a lack of TPR-2A, TPR-2J, TPR-2B, TPR-1C, and TPR-2D (Fig. 5gGo).


Figure 5
View larger version (31K):
[in this window]
[in a new window]

  		Figure 5. Comparison of the genomic DNA and mRNA of Ttc7+, Ttc7fsn-Jic, Ttc7fsn-hea, and Ttc7fsn-J. (a) and (e) are the possible structures of genomic DNA and mRNA of Ttc7+, (b) and (f) are those of Ttc7fsn-Jic, (c) and (g) are those of Ttc7fsn-hea, and (d) and (h) are those of Ttc7fsn-J. Dotted lines indicate the deleted genomic regions observed in Ttc7fsn-Jic and Ttc7fsn-hea. Two Ttc7fsn-Jic transcripts (f) were detected using RT-PCR, as shown in Figure 2Go. However, existence of the Ttc7fsn-hea transcript has not been found (8). The Ttc7 genomic DNA is approximately 100 kb in length, consisting of 20 exons. The Ttc7 mRNA is approximately 4.6 kb in length, including the 2577-bp coding region (858 amino acids). Among the letters A through I enclosed in circles, C and I are the TPR-1 repeats; B, E, F, G, and H are the TPR-2 repeats; and A and D are TPR-2 repeats determined from sequence context. This figure was drawn based on the report of Helms et al. (9).

 

   Discussion
Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
References
 
Molecular analyses performed in the present study revealed that the Ttc7fsn-Jic mutation is caused by a genomic in-frame deletion of exons 9 and 10. Comparing Ttc7fsn-J mice and Ttc7fsn-hea mice showing a large deletion of exons 1–14, there are few differences in their disease phenotypes, except a slightly different life span. This result leads to the conclusion that exon 9 and/or 10 of the Ttc7 gene may play an important role in biologic function of the TTC7 protein.

Two different amplicons were equally produced in the Ttc7fsn-Jic homozygotes by RT-PCR, as shown in Figure 2Go. It may be supposed that a 10-base deletion in intron 11 causes two different splicing events leading to two transcripts, deleting exons 9 and 10 and exons 9–11. We used a website (http://www.fruitfly.org/seq_tools/splice.html) to search specific sequences for splicing mutation. However, a query result showed this 10-base sequence does not predict any splicing mutations.

Using Northern blotting we demonstrated that Ttc7 transcripts are ubiquitously expressed in the normal mice in this study. Our results agreed with that of Helms et al. (9). Abnormalities observed in blood, skin, and other organs of the flaky skin mice lead to a hypothesis that Ttc7 mutations could cause the widespread flaky skin disease phenotypes, including hematopoietic and autoimmune disorders. Therefore, the TTC7 protein may play a fundamental role in the development or regulation of the immune system. This is in agreement with the multi-immunologic abnormalities in flaky skin mice. We conclude that various flaky skin diseases are brought about not by immunologic dysfunction but by the mutated TTC7 protein expressed ubiquitously in almost all tissues and organs.

TPR is a structural motif present in a wide range of proteins (24–26). It mediates protein-protein interactions and the assembly of multiprotein complexes (27). The Ttc7 gene codes 10 TPR domains that consist of 34 to 37 amino acids (8, 9). Five TPRs (2A, 2J, 2B, 1C, and 2D) are deleted in Ttc7fsn-hea (8), and one TPR (2B) is deleted in Ttc7fsn-Jic, as shown in this study. In Ttc7fsn-J, TPR-2D is disrupted due to insertion of the ETn transposon into intron 14 (8, 9). Helms et al. noted that the disruption of TPR-2D may affect its interaction with an as yet unidentified protein partner (9). They also found that a subset of Ttc7 transcripts in Ttc7fsn-J mice are wild type, indicating that the splicing of the ETn exon is leaky. This leaky splicing may bring about the longer life span of the Ttc7fsn-J mouse. These findings may suggest that a deletion of TPR-2B leads to a nearly complete loss of TTC7 function, which causes not only pleiotropic pathologic changes but also early postnatal death in both Ttc7fsn-hea and Ttc7fsn-Jic mutants.

In an association study of single nucleotide polymorphisms within TTC7A, the human ortholog of mouse Ttc7, Helms et al. (9) concluded that the TTC7A locus did not have a major role in psoriasis susceptibility in human psoriasis. However, even if TTC7 is not the gene responsible for human psoriasis, the mechanisms underlying psoriasis-like inflammatory skin lesions and the biologic roles of each TPR domain in the functions of the TTC7 protein should still be studied further.


   Footnotes
 
This work was supported in part by Grants-in-Aid for Scientific Research from the Ministry of Education, Culture, Sports, Science and Technology of Japan.

Received for publication July 6, 2006. Accepted for publication December 15, 2006.


   References
Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Schon MP. Animal models of psoriasis—what can we learn from them? J Invest Dermatol 112:405–410, 1999.
  2. Sundberg JP, Beamer WG, Shultz LD, Dunstan RW. Inherited mouse mutations as models of human adnexal, cornification, and papulosqu-amous dermatoses. J Invest Dermatol 95:62S–63S, 1990.[Medline]
  3. Beamer WG, Pelsue SC, Shultz LD, Sundberg JP, Barker JE. The flaky skin ( fsn) mutation in mice: map location and description of the anemia. Blood 86:3220–3226, 1995.[Abstract/Free Full Text]
  4. Pelsue SC, Schweitzer PA, Beamer WG, Shultz LD. Mapping of the flaky skin ( fsn) mutation on distal mouse chromosome 17. Mamm Genome 6:758, 1995.[Medline]
  5. Shimizu K, Keino H, Ogasawara N, Esaki K. Hereditary erythroblast anaemia in the laboratory mouse. Laboratory Anim 17:198–202, 1983.
  6. White RA, McNulty SG, Roman S, Garg U, Wirtz E, Kohlbrecher D, Nsumu NN, Pinson D, Gaedigk R, Blackmore K, Copple A, Rasul S, Watanabe M, Shimizu K. Chromosomal localization, hematologic characterization, and iron metabolism of the hereditary erythroblastic anemia (hea) mutant mouse. Blood 104:1511–1518, 2004.[Abstract/Free Full Text]
  7. Takabayashi S, Katoh H. A mutant mouse with severe anemia and skin abnormalities controlled by a new allele of the flaky skin ( fsn) locus. Exp Anim 54:339–347, 2005.[Medline]
  8. White RA, McNulty SG, Nsumu NN, Boydston LA, Brewer BP, Shimizu K. Positional cloning of the Ttc7 gene required for normal iron homeostasis and mutated in hea and fsn anemia mice. Genomics 85: 330–337, 2005.[Medline]
  9. Helms C, Pelsue S, Cao L, Lamb E, Loffredo B, Taillon-Miller P, Herrin B, Burzenski LM, Gott B, Lyons BL, Keppler D, Shultz LD, Bowcock AM. The tetratricopeptide repeat domain 7 gene is mutated in flaky skin mice: a model for psoriasis, autoimmunity, and anemia. Exp Biol Med (Maywood) 230:659–667, 2005.[Abstract/Free Full Text]
  10. Abernethy NJ, Hagan C, Tan PL, Watson JD. Dysregulated expression of CD69 and IL-2 receptor alpha and beta chains on CD8+ T lymphocytes in flaky skin mice. Immunol Cell Biol 78:596–602, 2000.[Medline]
  11. Nanney LB, Sundberg JP, King LE. Increased epidermal growth factor receptor in fsn/fsn mice. J Invest Dermatol 106:1169–1174, 1996.[Medline]
  12. Morita K, Hogan ME, Nanney LB, King LE Jr, Manabe M, Sun TT, Sundberg JP. Cutaneous ultrastructural features of the flaky skin ( fsn) mouse mutation. J Dermatol 22:385–395, 1995.[Medline]
  13. Schon M, Behmenburg C, Denzer D, Schon MP. Pathogenic function of IL-1 beta in psoriasiform skin lesions of flaky skin ( fsn/fsn) mice. Clin Exp Immunol 123:505–510, 2001.[Medline]
  14. Mattsson N, Duzevik EG, Pelsue SC. Expansion of CD22lo B cells in the spleen of autoimmune-prone flaky skin mice. Cell Immunol 234: 124–132, 2005.[Medline]
  15. Abernethy NJ, Hagan C, Tan PL, Birchall NM, Watson JD. The peripheral lymphoid compartment is disrupted in flaky skin mice. Immunol Cell Biol 78:5–12, 2000.[Medline]
  16. Pelsue SC, Schweitzer PA, Schweitzer IB, Christianson SW, Gott B, Sundberg JP, Beamer WG, Shultz LD. Lymphadenopathy, elevated serum IgE levels, autoimmunity, and mast cell accumulation in flaky skin mutant mice. Eur J Immunol 28:1379–1388, 1998.[Medline]
  17. Welner R, Swett DJ, Pelsue SC. Age-related loss of bone marrow pre-B- and immature B-lymphocytes in the autoimmune-prone flaky skin mutant mice. Autoimmunity 38:399–408, 2005.[Medline]
  18. Withington S, Maltby-Askari E, Welner R, Parker R, Pelsue SC. Antinuclear autoantibodies in flaky skin ( fsn) mutant mice. Auto-immunity 35:175–181, 2002.[Medline]
  19. Schon M, Denzer D, Kubitza RC, Ruzicka T, Schon MP. Critical role of neutrophils for the generation of psoriasiform skin lesions in flaky skin mice. J Invest Dermatol 114:976–983, 2000.[Medline]
  20. Sundberg JP, France M, Boggess D, Sundberg BA, Jenson AB, Beamer WG, Shultz LD. Development and progression of psoriasiform dermatitis and systemic lesions in the flaky skin ( fsn) mouse mutant. Pathobiology 65:271–286, 1997.[Medline]
  21. Sundberg JP, Boggess D, Sundberg BA, Beamer WG, Shultz LD. Epidermal dendritic cell populations in the flaky skin mutant mouse. Immunol Invest 22:389–401, 1993.[Medline]
  22. Sundberg JP, Kenty GA, Beamer WG, Adkison DL. Forestomach papillomas in flaky skin and steel-Dickie mutant mice. J Vet Diagn Invest 4:312–317, 1992.[Abstract/Free Full Text]
  23. Welner R, Hastings W, Hill BL, Pelsue SC. Hyperactivation and proliferation of lymphocytes from the spleens of flaky skin (fsn) mutant mice. Autoimmunity 37:227–235, 2004.[Medline]
  24. Lamb JR, Tugendreich S, Hieter P. Tetratrico peptide repeat interactions: to TPR or not to TPR? Trends Biochem Sci 20:257–259, 1995.
  25. Das AK, Cohen PW, Barford D. The structure of the tetratricopeptide repeats of protein phosphatase 5: implications for TPR-mediated protein-protein interactions. EMBO J 17:1192–1199, 1998.[Medline]
  26. Goebl M, Yanagida M. The TPR snap helix: a novel protein repeat motif from mitosis to transcription. Trends Biochem Sci 16:173–177, 1991.[Medline]
  27. D’Andrea LD, Regan L. TPR proteins: the versatile helix. Trends Biochem Sci 28:655–662, 2003.[Medline]




This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Takabayashi, S.
Right arrow Articles by Katoh, H.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Takabayashi, S.
Right arrow Articles by Katoh, H.

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS