EBM Email Content Delivery
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
QUICK SEARCH:   [advanced]


     

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF) Free
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Villalpando, I.
Right arrow Articles by Echeverria, O.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Villalpando, I.
Right arrow Articles by Echeverria, O.
Experimental Biology and Medicine 233:419-426 (2008)
doi: 10.3181/0708-RM-212
© 2008 Society for Experimental Biology and Medicine

ORIGINAL RESEARCH ARTICLE

Insulin-Like Growth Factor 1 Is Expressed in Mouse Developing Testis and Regulates Somatic Cell Proliferation

Irma Villalpando*,1, Esmeralda Lira*, Georgina Medina*, Erick Garcia-Garcia{dagger} and Olga Echeverria{ddagger}

* Departamento de Biología Celular y Fisiología; {dagger} Departamento de Inmunología, Instituto de Investigaciones Biomédicas; and {ddagger} Departamento de Microscopia Electrónica, Facultad de Ciencias, Universidad Nacional Autónoma de México, Ciudad Universidad, México D.F. 04510

1 To whom requests for reprints should be addressed at Departamento de Biología Celular y Fisiología, Instituto de Investigaciones Biomédicas, UNAM, Apartado Postal 70228, México D.F 04510, Mexico. E-mail: villalpando{at}biomedicas.unam.mx


   Abstract
Top
 Abstract
Introduction
 Material and Methods
 Results
 Discussion
 References
 
Testicular development occurs prenatally in mammals. The developmental underlying mechanism is only partially understood. The aim of the present investigation was to study the expression of the gene coding for insulin-like growth factor 1 (Igf-1) and Igf-1 type 1 receptor (Igf-1r) and their respective proteins in mouse Sertoli and Leydig cells at gestation day 12 (E12)–E18. Moreover, we sought to determine the effect of IGF-1 on the proliferation of both cell types and to establish the signal transduction mechanism involved in the IGF-1 pathway. Transcripts for the Igf-1 and Igf-1r genes were found in Sertoli and Leydig cells from E12–E18. Highest IGF-1 and IGF-Ir protein expression levels were found in both cell types at E18. Exogenous IGF-1 administration increased Sertoli and Leydig cell proliferation at E14–E18 in vitro. Inhibition of the pathway mitogen-activated extracellular signal-regulated protein kinase (MEK) 1/2 with UO126 diminished the proliferation of the Sertoli and Leydig cells in vitro. We propose that IGF-1 and IGF-1r regulate Sertoli and Leydig cell proliferation through the MEK/extracellular-signal-regulated kinase (ERK) 1/2 signal transduction pathway, leading to development and growth of the mouse embryonic testis.

Key Words: IGF-1 • testis • proliferation • Leydig cell • Sertoli cell


   Introduction
Top
 Abstract
 Introduction
Material and Methods
 Results
 Discussion
 References
 
During mouse gonadal development, the primary testis-determining Sry gene is necessary to induce down-regulation of other important genes leading to the male differentiation pathway (1). The crucial role for the insulin and insulin-related proteins, such as IGF-1, was established for mouse testicular differentiation (2, 3). Targeting experiments demonstrated the importance of IGF-1 for the development and fate of the mouse male gonad (4). It has been proposed that locally produced IGF-1 plays both an autocrine and paracrine function in the adult testis (5–7); however, the precise role of IGF-1 in the context of the developing testis remains to be clarified. One of the most studied aspects of IGF-1 is its function as a regulator of the expression of key steroidogenic enzymes in the embryonic and postnatal testes of mammals (8–12). IGF-1 is expressed in the testis of various species in the adult Leydig and Sertoli cells (5–7). The biological action of IGF-1 is elicited through a trans-membrane receptor, which is a tetrameric complex composed of two {alpha} and two β subunits (13). The mRNA for IGF-1r is found in the rat spermatocytes and spermatids of the adult testis (14–16). IGF-1r expression has also been described in rat testis (17). On the other hand, it is known that proliferation is a process finely regulated by oncogenes, proteins, cyclin-dependent kinase complexes, and growth factors such as IGF-1 (18–20). Previous investigations demonstrated that IGF-1 activates transition stages of various cellular types in adult tissues (12, 21). However, the role of IGF-1 as regulator of Leydig and Sertoli cell proliferation in the developing testis remains controversial at the present time. To gain insight into the role of IGF-1 in the mouse prenatal testis, we studied Igf-1 and Igf-1r gene and protein expression, as well as the IGF-1 effect on Sertoli and Leydig cell proliferation, in mice developing testis.


   Material and Methods
Top
 Abstract
 Introduction
 Material and Methods
Results
 Discussion
 References
 
Animal Breeding and Generation of Embryos.
CD1 mice were maintained and handled according to the National Institutes of Health Guide for the Care and Use of Laboratory Animals (NIH 85–23, revised 1985). All methods used in this investigation were approved by the Internal Council and the Animal Care Committee of the Instituto de Investigaciones Biomédicas, Universidad Nacional Autónoma de México. Four adult, eight-week-old female breeders were caged with a male of the same age. Females with a vaginal plug on the day subsequent to mating were considered to be at day 0 of pregnancy. Pregnant females at 12, 14, 16, and 18 days of pregnancy were sacrificed by cervical dislocation. The embryos were dissected out from the uterus and immediately sacrificed. The testes were isolated and collected in Dulbecco’s modified Eagle medium (D-MEM).

Identification of Testis.
Mouse embryos of the above-mentioned ages were staged according to limb development as previously described (22) and are referred to hereafter as E12 (onset of testicular differentiation), E14 (beginning of growth), E16 (fetal stage), and E18 (perinatal period). Male gonads were identified by the presence of the highly vascularized testis as shown under a stereo microscope (23).

Reverse Transcriptase Polymerase Chain Reaction (RT-PCR) Analysis.
To determine Igf-1 and Igf-1r expression, testes at stages E12–E18 were separated under a stereo microscope and frozen at –20°C. Total RNA from pooled testes was purified using Trizol-guanidinium-thiocyanate (Life Technologies, Gaithersburg, MD). One microgram of total RNA was reverse transcribed with 200 units of M-MLV reverse transcriptase (Applied Biosystems, Branchburg, NJ) in a total volume of 50 µl. Igf-1 and Igf-1r receptor genes were amplified by RT-PCR according to the protocol provided by the manufacturer. Oligonucleotide sequence primers were synthesized by Life Technologies and used at 100 pg. The oligonucleotide sequences for Igf-1 and the β-actin oligonucleotide were those previously described (8) for Igf-Ir as follows: sense 5'CACTCTGTACCGCATCGATATC3', antisense 5'GGCAACCGGCAGAGCAATGATC3'. A total of 40 cycles were used to amplify the Igf-Ir: 94°C 60-sec denaturation; 58°C 90-sec annealing, and elongation at 72°C for 2 mins or 20 mins in the last cycle. RT-PCR products were separated by electrophoresis and visualized by ethidium bromide staining. A low DNA Mass Ladder was used as a standard marker (Life Technologies). In each experiment, negative control reactions were performed under the same experimental conditions in the absence of reverse transcriptase. At least three independent experiments using four male gonads at E12–E18 were performed.

Determination of Endogenous IGF-1 in the Testis.
The amount of endogenous IGF-1 produced by testicular cells was analyzed by radioimmunoassay. Male gonads from E12–E18 were isolated, and 40 testes were pooled for each developmental stage analyzed. Briefly, samples were homogenized, IGF-1 was separated from its binding proteins by acid ethanol extraction as described before (24), and samples were processed for radioimmunoassay according the manufacturer’s protocol using an IGF-1 DSL, 5600 extraction kit (Diagnostic Systems Laboratories, Webster, TX). The sensitivity limit of the assay was 1 pg, and the interassay coefficient was 8.7 for a sample containing 1 pg/ml. The IGF-1 production was measured in developing testis in three independent experiments, with freshly obtained testes isolated for each developmental stage.

Isolation of Leydig and Sertoli Cells.
The embryonic testes at E16–E18 were isolated and placed in D-MEM and processed independently according to the technique described before (25), with slight modifications. Briefly, testes were rinsed twice with Ca++- and Mg++-free phosphate-buffered saline (PBS) and incubated with 0.2 mg/ml collagenase-dispase and 0.1 mg/ml DNase I (Roche, Indianapolis, IN) for 10–15 mins at 37(C according to their developmental stage. Gonads were then mechanically disaggregated with a sterile, siliconized Pasteur pipette with Sigmacote (Sigma, St. Louis, MO). The enzyme was inhibited with 0.2% trypsin inhibitor (GIBCO, Carlsbad, CA), and cells were allowed to sediment at room temperature for 15 mins. The supernatant containing Leydig cells was separated and centrifuged at 1894 g for 5 mins. The sedimented fraction containing Sertoli cells was treated with 0.1% trypsin for 1–3 mins, and enzyme activity was inhibited. The pellet was resuspended in D-MEM cultured medium supplemented as described before (8). To synchronize cells 1 x 106, Leydig and Sertoli cells were incubated with 10% of bovine fetal serum. Sertoli cells were seeded in F12:D–MEM 1:1. After 24 hrs of culture, the medium was removed and the cells were cultured with fresh medium, without bovine fetal serum, to eliminate germ cells (26). The following day, Sertoli and Leydig cells were cultured in the presence of 10 µm of bromodeoxyuridine (BrdU) and 100 ng of recombinant IGF-1 for 24 hrs. Cells were normalized, taking into consideration BrdU-unlabeled and -labeled cells, and results were expressed as percentage of labeled Sertoli and Leydig cells. Each experiment was performed at least five times in each stage described.

Identification of Sertoli and Leydig Cells.
The purity of Sertoli and Leydig cells fraction was established by the histochemical detection of 3β-hydroxysteroid dehydrogenase activity (3β-HSD) according the technique described previously (27). Positive cells to 3β-HSD revealed that 96% of the cells in the preparations were Leydig cells. Myoid cell percentage was established by immunocytochemistry with a muscle alpha actin antibody (Novocastra Laboratories, Newcastle upon Tyne, United Kingdom). Immunostaining revealed the presence of <1% of myoid cells. Sertoli cells were identified by Müllerian inhibiting substance expression (R & D System, Minneap-olis, MN), and the presence of reproductive cells was excluded by phosphatase alkaline staining (28). No reproductive cells were observed in Sertoli cells cultured in the absence of bovine fetal serum.

Immunocytochemistry.
Immunodetection of IGF-1 and the {alpha} and β subunits of IGF-1r was performed in cultured Sertoli and Leydig cells grown on round coverslips coated with 0.2% collagen by indirect immunoperoxidase activity. Endogenous peroxidase was blocked with 0.3% H2O2, and unspecific staining was blocked with 5% bovine serum albumin. Samples were rinsed and incubated overnight at room temperature with an anti-rabbit IGF-1 antibody at a 1:20 dilution or an anti-goat IGF-1r antibody (R & D System) at a 1:10 dilution. Immunostaining was performed following the manufacturer’s instructions from ABC Kit (Vector Laboratories, Burlingame, CA). Peroxidase activity was revealed with 0.3% H2O2 using 3,3' diaminobenzidine tetrachloride, and the reaction was stopped with distilled water. Primary antibody for IGF-1 and IGF-Ir was omitted as a negative control.

Flow Cytometry Cell Cycle of Somatic Testicular Cells.
Flow cytometry cell cycle analysis in Leydig and Sertoli cells at 18 days of gestation was performed essentially as previously described (29), with minor modifications. Briefly, Sertoli and Leydig cells (1 x 106) in 300 µl of PBS were permeabilized by adding 0.75 µl of 10% Triton X-100 in PBS. Then, 30 µl of 10 mg/ml RNAse solution was added simultaneously to the cell suspension in order to eliminate propidium iodide staining of double-stranded RNA. After 30 mins of incubation at 37°C, 5 µl of a 100-µg/ml solution of propidium iodide was added to the cell suspensions. Cells were incubated at 37°C for 30 mins and were finally fixed by adding 100 µl of 10% paraformaldehyde in PBS. Flow cytometric analysis was performed using a FACScan apparatus (Becton Dickinson, Franklin Lakes, NJ) with logarithmic amplification of the side scatter and forward scatter parameters. Propidium iodide fluorescence was detected using the FL-2 channel set at 564 with linear amplification. A standard of DNA content was obtained by serum-starving Leydig cells for 4 days. To evaluate the effect of IGF-1 on the cell cycle, Leydig or Sertoli cells were treated with and without 100 ng/ml of recombinant IGF-1 for 24 hrs, in the presence or absence of 30 µM of the MEK 1/2 UO126 inhibitor.

Statistical Analysis.
The effect of IGF-1 on Sertoli and Leydig cell proliferation was analyzed with variance analysis followed by Student’s t test. The IGF-1 produced in the male gonad was analyzed with one-way ANOVA followed by the Tukey test with the program SAS 6.02 (SAS Institute Inc., Cary, NC), with significance set at P < 0.05.


   Results
Top
 Abstract
 Introduction
 Material and Methods
 Results
Discussion
 References
 
Transcripts for Igf-1 and Igf-1r Genes are Expressed in Somatic Cells of the Mouse Embryonic Testis.
The onset of Igf-1r mRNA expression was at E12; at this stage, we detected a faint expression in the entire mouse testis. At E14, transcripts for the Igf-1r gene were moderately higher than the expression levels found in the previous stage. Igf-1r gene expression increased according to developmental stages in the testis at E16–E18 (Fig. 1Go). Lengths of the amplified genes were 442 and 352 bp for the Igf-1r and β-actin genes, respectively.


Figure 1
View larger version (41K):
[in this window]
[in a new window]

  		Figure 1. Igf-Ir expression analyzed by RT-PCR in the mouse testis, in the presence (+) and absence (–) of reverse transcriptase. MW, molecular weight standard. Expected fragment sizes for Igf-1r and β-actin amplified genes were 442 and 352 bp, respectively.

 
Testicular Cells Expressed IGF-1 and IGF-1r.
Faint staining for the IGF-1 protein was observed in the cytoplasm of Leydig and Sertoli cells at E12 and E14. Expression of IGF-1 increased moderately at E16, and immunostaining at this stage was detected in the nucleus of Leydig cells (data not shown). At E18, the highest IGF-1 protein expression in this cell type was observed in the nucleus, while fainter staining was found in the cytoplasm (Fig. 2AGo; x20). No immunostaining was found in the control cells (Fig. 2BGo; x20). The {alpha} and β subunits of the type 1 receptor also exhibited high staining in the nucleus of Leydig cells (Figs. 2C–EGo, x40 and x20, respectively). Note the absence of expression of {alpha} and β subunit receptors of the type 1 receptor in the cells of the control group (Fig. 2D–FGo; x20). IGF-1 expression in Sertoli cells was observed mainly in the cytoplasm (Fig. 2GGo; x40). No staining was seen in the cytoplasm of these cells (Fig. 2HGo; x20). The IGF-I β receptor subunit showed moderate staining in the nucleus of Sertoli cells, whereas higher immunostaining for the {alpha} subunit was detected in the nuclear compartment of these cell types (Fig. 2I–KGo; x40). No immunostaining was seen in Sertoli cells in the absence of the {alpha} and β subunit antibodies (Fig. 2J–LGo; x40).


Figure 2
View larger version (53K):
[in this window]
[in a new window]

  		Figure 2. Igf-I and Igf-1r gene and protein expression in mouse testicular cells. A. IGF-1 moderate staining was located in the cytoplasm of Leydig cells, whereas higher immunostaining was observed in the nucleus (N). x20. B. Control of IGF-I staining. Note the absence of staining in the cultured Leydig cells. x20. C. Shows staining for β subunit of IGF-1r . The β subunit was also found in the nucleus (N), while fainter staining was seen in the cytoplasm (C) of Leydig cells. x40. D. No immunostaining was found in the absence of the first antibody. x20. E. The {alpha} subunit of the type 1 receptor was also seen in the nucleus (N) of Leydig cells. x20. F. In the control group, an immunostaining pattern was absent in the cells. x20. G: IGF-1β receptor expression in the cytoplasm of Sertoli cells can be observed. x40. H. No immunoreaction was detected in the cytoplasm of Sertoli cells.x20. I. Sertoli cells moderately expressed the β subunit receptor in the nucleus (N). x40. J No staining was seen in the cytoplasm or nucleus of this cell type. x40. K. Expression of IGF-I {alpha} subunit receptor in the nucleus (N) of Sertoli cells. x40. L. Note the absence of immunostaining in cultured Sertoli cells of the mouse testis. x40.

 
Embryonic Mouse Testis Produced IGF-1.
At E12, IGF-1 was undetectable in the testis by radioimmunoassay. In contrast, the amount of endogenous IGF-1 detected at E14 was 11 pg/ml, and its production increased to 14 pg/ml at E16. The highest value observed was 19 pg/ml at E18. The observed differences were statistically significant, with *P < 0.05, with the Tukey test (Fig. 3Go).


Figure 3
View larger version (10K):
[in this window]
[in a new window]

  		Figure 3. Endogenous IGF-1 production in the mouse testis analyzed by radioimmunoassay. The bars indicate the mean ± SE from 3 experiments. *P < 0.05 by the Tukey test.

 
IGF-1 Induced Leydig Cell Proliferation.
At E12, we did not find any differences in proliferation between the control and IGF-1–treated Leydig cells by BrdU staining. At E14, 40% of the Leydig cells in the control group were BrdU-labeled, whereas in the IGF-1–treated cells, we observed 60% of BrdU incorporation. At E16, 32% of the Leydig cells in the control were BrdU-labeled, while 68% were BrdU labeled after IGF-1 treatment. At E18, the percentage of BrdU-positive cells in the control was 31%, while the percentage of labeled cells observed in the IGF-1–treated samples was 69% (Fig. 4Go). Statistical analysis revealed that differences found at E14 and E18 in the IGF-1–treated samples with respect to controls were statistically significant, *, **, ***P < 0.05, respectively, with Student’s t test.


Figure 4
View larger version (8K):
[in this window]
[in a new window]

  		Figure 4. Proliferation of mouse Leydig cells analyzed by BrdU incorporation. Data represent the mean ± SE from five independent experiments. *P < 0.05 IGF-1, compared with control group at 14 days of gestation. **P < 0.05 compared with control group at 16 days of gestation. ***P < 0.05 compared with control group at 18 days of gestation by Student’s t test.

 
IGF-1 Promoted Sertoli Cell Proliferation.
At E14, 54% of BrdU-positive Sertoli cells were found in the control group, whereas in the IGF-1–treated cells, we detected 46% of BrdU incorporation. At E16, 39% of Sertoli cells were BrdU-labeled in the control group, while 61% of the cells were BrdU-labeled in the group incubated with IGF-1. At E18, BrdU incorporation found in the control group was 46%, while the percentage of BrdU-positive cells observed in the IGF-1–treated samples was 54% (Fig. 5Go). Statistical analysis revealed that no statistically significant differences were observed at E14 in the control samples compared with IGF-1–treated cells. Differences found in the control group with respect to the IGF-1–treated group were statistically significant at E16–E18, *, **P < 0.05, respectively, with Student’s t test (Fig. 5Go).


Figure 5
View larger version (8K):
[in this window]
[in a new window]

  		Figure 5. Proliferation of Sertoli cells analyzed by BrdU incorporation. The bars represent the mean ± SE from five independent experiments. P < 0.05 IGF-1 compared with the control group at 14 days of gestation. *P < 0.05, IGF-1 compared with the control group at 16 days of gestation. **P < 0.05, IGF-1 compared with the control group at 18 days of gestation, Student’s t test.

 
Flow Cytometric Analysis of the Sertoli and Leydig Cell Cycle.
In the absence of IGF-1, 64% of the Leydig cells remained in the G0/G1 phase of the cell cycle; however, after IGF-1 treatment, this percentage was reduced to 47%. This difference from the control cells was statistically significant at *P < 0.01 (Fig. 6Go). The percentage of Leydig cells remaining in G0/G1 was 54% when cells were treated with the MEK/ERK inhibitor UO126 before IGF-1 stimulation. In the absence of IGF-1, only 24% of the Leydig cells were found in the S phase of the cell cycle. This percentage increased to 43% when Leydig cells were treated with IGF-1, and this difference was statistically significant at *P < 0.007. Leydig cells in the S phase were 35% when treated with UO126 before IGF-1 stimulation. No significant differences were found in the G2/M phase of the cell cycle between control and IGF-1–treated Leydig cells, 12% and 11%, respectively. However, the inhibition of MER/ERK 1/2 reduced the percentage of Leydig cells in G2/M to 7%, and this difference from the control cells was statistically significant at *P < 0.02 (Fig. 6Go).


Figure 6
View larger version (16K):
[in this window]
[in a new window]

  		Figure 6. The effect of IGF-1 on the cell cycle of Leydig cells studied by flow cytometry. Treating cells with IGF-1 decreased the percentage of cells in the G0/G1 phase of the cell cycle, thus inducing a concomitant increase in the percentage of cells in either the S or G2/M phases. Inhibition of the MEK/ERK 1/2 pathway with the UO126 inhibitor reversed the IGF-1 effect. In the G0/G1 phase, *P < 0.01 for IGF-1 compared to control group. In the S phase, *P < 0.007 for IGF-1 compared to control group. In the G2/M phase, *P < 0.02, for IGF-1 compared to control group.

 
The percentage of Sertoli cells in the G0/G1 phase of the cell cycle was 45% in the absence of IGF-1, and was reduced to 36% after IGF-1 stimulation. Treating Sertoli cells with UO126 before IGF-1 stimulation resulted in 51% of the cells remaining in the G0/G1 phase of the cell cycle (Fig. 7Go). In the absence of IGF-1, 33% of the Sertoli cells were in the S phase, and this percentage increased to 43% after IGF-1 stimulation. Treating Sertoli cells with UO126 before IGF-1 stimulation reduced the percentage of cells in the S phase to 32%. Differences from the control samples were statistically significant at *P < 0.02. In the absence of IGF-1, 13% of the Sertoli cells were in the G2/M phase of the cell cycle, and this percentage increased to 19% after IGF-1 stimulation. Treating Sertoli cells with UO126 before IGF-1 stimulation reduced the percentage of cells in the G2/M phase to 14%. Differences from control samples were statistically significant at *P < 0.02.


Figure 7
View larger version (16K):
[in this window]
[in a new window]

  		Figure 7. IGF-1 effect on the cell cycle of Sertoli cells analyzed by flow cytometry. Treating cells with IGF-1 diminished the percentage of cells in the G0/G1 phase of the cell cycle, thus promoting a concomitant increase in the percentage of cells in either the S or G2/M phases. Inhibition of the MEK/ERK 1/2 pathway with the UO126 inhibitor reversed the IGF-1 effect. In the S phase, *P < 0.02 for IGF-1 treatment with respect to the control group. In the G2/M phase, *P < 0.02 for IGF-1 with respect to the control group.

 
Administration of the UO126 in the absence of IGF-1 had no effect on the Sertoli and Leydig cell cycle (data not shown).


   Discussion
Top
 Abstract
 Introduction
 Material and Methods
 Results
 Discussion
References
 
We demonstrated for the first time Igf-1 and Igf-1r gene and protein expression in the embryonic mouse testis. These results are consistent with those from previous studies in which it was found, through use of RT-PCR, that transcripts for the Igf-1 gene are expressed in the urogenital ridge at 10.5 days of gestation in the entire testis (8). The IGF-1 protein appears to be expressed to a lesser extent than its mRNA in the male gonad at the onset of testicular development at E12. Measurement of endogenous IGF-1 production by radioimmunoassay experiments revealed that embryonic testes produce small amounts of IGF-1 at E14–E18 (11–19 pg/ml). It may be possible that the small amount of endogenous IGF-1 produced in the mouse testis at this stage is used to regulate other important functions, such as testosterone production. It has been described that endocrine activity of the male gonad starts at 12 days of gestation in the mouse (8).

It was interesting to find that Sertoli cells still have the capacity to proliferate at major stages of testis growth at the fetal (E16) and perinatal (E18) periods. These findings agree with those from previous reports which describe that the major peak of Sertoli proliferation is at 18 days of gestation in the rat (30). Our results demonstrate that proliferation of embryonic somatic cells is coordinated by IGF-1. It is likely that IGF-1 activates D-type cyclins or other growth factors that regulate testis growth. The activation of distinct D-type cyclins has been described in the mouse embryonic gonad (19, 20).

On the other hand, the dynamics of Leydig cell proliferation show that exogenous IGF-1 promotes proliferation from E14–E18. The high percentage of proliferating Leydig cells found with IGF-1 could be related to fetal testis being required to synthesize more steroids to maintain the male phenotype (1). The data presented here are in opposition to findings from previous investigations showing no effect of IGF-1 on Leydig cell proliferation at 16.5 and 18.5 days in the rat embryonic testis (25). These differences in Leydig cell proliferation may be explained by the lower dose of IGF-1 (50 ng) used in the previous study. We found that 50 ng of IGF-1 had no effect on Leydig or Sertoli cell proliferation. However, differences between rodent species may also be responsible for the observed effects of IGF-1 in rat and mouse testes. The finding that both Igf-1 and Igf-1r are simultaneously expressed in Sertoli and Leydig cells suggests that mouse fetal testis is autocrinally regulated. The MEK/ERK 1/2 inhibitor diminished proliferation of Sertoli and Leydig cells, thus suggesting that proliferation is regulated through the mitogen-activated protein (MAP)-kinase signaling pathway. We found that IGF-1 was located in the nucleus of the somatic testicular cells (unpublished data). Location of IGF-1 in the nucleus suggests that this growth factor probably activates other proteins required for testicular function, as has been observed in the nucleus of the hepatocyte (31). We observed IGF-I strong staining in the nucleus of Leydig cells, whereas in Sertoli cells, this pattern was absent. It is likely that the presence of IGF-1 in the nucleus of Leydig cells may be related to the state of differentiation of the cell. Experiments performed in the embryonic chicken lens demonstrated that IGF-I accumulates in the nuclei of epithelial cells, but not in the fiber cells (32). These findings suggest that transport of IGF-I to different subcellular compartments may be related to the state of differentiation of the cells.

Furthermore, interesting experiments performed in opossum kidney cells demonstrated that both IGF-I and the IGF-I binding protein 3 (IGFBP3) are internalized to the endosome compartment in resting cells. In contrast, in proliferating cells, IGF-I and IGFBP3 accumulated in the nucleus (33).

We found that IGF-Ir was located in the nucleus of Leydig cells. This finding suggests that the IGF-1 receptor could be transported to the nuclear compartment. At the present time, there is no evidence to support this observation. However, experiments performed in various cell lines and IGF-I target cells demonstrated that the IGF-I receptor is necessary to translocate the insulin receptor substrates (IRS) 1–3 to the nucleus. Mutation of the tyrosine kinase domains on these proteins abolishes their translocation to the nucleus (34). An IGF-I receptor subunit was found in the nucleus of Leydig cells. It is possible that the IGF-Ir and the IRS share some homology (34). However, our antibodies were specific to detect the receptors described here. It is thus likely that the immunoreaction observed in the nucleus of this cell type can be due to endogenous IGF-I activating its signaling pathway, leading to activation of the IGF-I receptor, which in turn is used for nuclear translocation of IRS.

Our results demonstrate the importance of IGF-1 expression for growth and function of postnatal testes. Igf-1 knockout mice are infertile dwarfs that sustained spermatogenesis by, on average, 17%–18%, and their testes were smaller, but less than what was expected, compared with their wild type litter mates (3). These findings indicate that Igf-I knockout testis was fine, suggesting a posterior compensation by other factors.

We rule out that IGF-1 is induced in vitro, since we tested IGF-I expression in isolated cells before starting and after one, two, or three days of culture, and observed that IGF-I expression was maintained (unpublished data).

We have previously demonstrated that transcripts for Igf-1 are expressed since the beginning of testicular development at 12–18 days of gestation and that their expression increased according to age (8). Igf-1 transcripts are also found in isolated cells tested after one, two, or three days of culture (unpublished data). Therefore, it is reasonable to think that IGF-I is naturally expressed.

Previous data obtained by our group (8) and the present results demonstrate that IGF-1 plays a dual role during testis development, first as an enhancer of steroid hormone production (8), and second, as regulator of Leydig and Sertoli cell proliferation in the mouse prenatal testis. Similar functions of IGF-1 have been shown in the testis of adult mammals (11). Proliferation percentage observed in the Sertoli and Leydig cells along testicular development could be related to the receptor number present at each developmental stage. The available receptor number for IGF-1 appears to vary according study tissue (35). Finally, we propose that IGF-1 regulates proliferation autocrinally, through an MAPkinase-signaling pathway, leading to the differentiation and growth of mouse testis.


   Acknowledgments
 
We thank Tzipe Govezensky–Zack for statistical analysis and Marcos Martínez Reyes for figure preparation.


   Footnotes
 
This study was supported by research grants IN204802 and IN206205-2 from Dirección General de Asuntos del Personal Académico-, Universidad Nacional Autónoma de México.

Received for publication August 7, 2007. Accepted for publication November 28, 2007.


   References
Top
 Abstract
 Introduction
 Material and Methods
 Results
 Discussion
 References
 

  1. Wilhelm D, Palmer S, Koopman P. Sex determination and gonadal development in mammals. Physiol Rev 87:1–28, 2007.[Abstract/Free Full Text]
  2. Nef S, Verma-Kuravi S, Merenmies J, Vasalli JD, Efstratiadis A, Accilli D, Parade LF. The testis determination requires insulin receptor family function in mice. Nature 426:291–295, 2003.[CrossRef][Medline]
  3. Baker J, Hardy MP, Zhow J, Bondy C, Lupu F, Bellelvé AR, Efstratiadis A. Effects of an IGF-I null mutation on mouse reproduction. Mol Endocrinol 10:903–918, 1996.[Abstract/Free Full Text]
  4. Baker J, Liu JP, Robertson EJ, Efstratiadis A. Role of the insulin-like growth factors in embryonic and postnatal growth. Cell 75:73–82, 1993.[CrossRef][Medline]
  5. Liu P-L, Baker J, Perkin LA, Robertson EJ, Efstratiadis A. Mice carrying null mutation of the genes encoding insulin-like growth factor I (Igf-1) and the type one receptor. Cell 15:59–72, 1993.
  6. Bardin CW, Morris PL, Chen CC. Autocrine and paracrine gonadal peptides. Recent Progr GnR Gonad Pept 39:367–368, 1990.
  7. Stewart C, Rotwein P. Growth differentiation and survival: multiple physiological functions for insulin-like growth factors. Physiol Rev 76: 1205–1026, 1996.
  8. Villalpando I, Lopez-Olmos V. Insulin-like growth factor I (IGF-I) regulates endocrine activity of the embryonic testis in the mouse. J Steroid Biochem Mol Biol 86:151–158, 2003.[CrossRef][Medline]
  9. Chuzel F, Clark AM, Avallet O, Saez JM. Transcriptional regulation of the lutropin/human choriogonadotropin receptor and three enzymes of steroidogenesis by growth factors in cultured pig Leydig cells. Eur J Biochem 239:8–16, 1996.[Medline]
  10. Kasson BG, Hsueh AJ. Insulin-like growth factor I augments gonadotrophin stimulated androgen biosynthesis by cultured rat testicular cells. Mol Cell Endocrinol 52:27–34, 1987.[CrossRef][Medline]
  11. Wang GM, O’Shaughnessy PJ, Chubb C, Robaire B, Hardy MP. Effects of insulin-like growth factor I on steroidogenic enzyme expression levels in mouse Leydig cells. Endocrinology 144:5058–5064, 2003.[Abstract/Free Full Text]
  12. Moore A, Morris ID. The involvement of the insulin-like growth factor I in local control of steroidogenesis and DNA synthesis of Leydig and non-Leydig cells in rat testicular interstitium. J Endocrinol 138:107–114, 1993.[Abstract/Free Full Text]
  13. LeRoith D, Werner H, Beitner-Johnson D, Roberts CT. Molecular and cellular aspects of the insulin-like growth factor I receptor. Endocr Rev 16:143–163, 1995.[Abstract/Free Full Text]
  14. Murphy JL, Bell GI, Friesen HG. Tissue distribution of the insulin-like growth factor I and II messenger ribonucleic acid in the adult rat. Endocrinology 120:1279–1282, 1987.[Abstract/Free Full Text]
  15. Lin R, Haskell J, Vinson N, Terracio L. Characterization of the insulin and insulin-like growth factor I receptors of purified Leydig cells and their role in steroidogenesis in primary culture: a comparative study. Endocrinology 119:1641–1647, 1986.[Abstract/Free Full Text]
  16. Lin T, Wang D, Calkins JH, Guo H, Chi R, Housley PR. Regulation of the insulin-like growth factor-I messenger ribonucleic acid expression in Leydig cells. Mol Cell Endocrinol 73:147–152, 1990.[CrossRef][Medline]
  17. Handelsman DJ, Spaliviero JA, Scott CD, Baxter RC. Identification of the insulin-like growth factor I and its receptors in rat testis. Acta Endocrinol 109:543–549, 1985.[Medline]
  18. Johnson DG, Walke CL. Cyclins and cell cycle checkpoints. Annu Rev Pharmacol Toxicol 39: 259–312, 1999.
  19. Moore GD, Ayabe T, Kopf GS, Schultz RM. Temporal patterns of gene expression of G1-S cyclins and cdks during the first and second mitotic cell cycles in mouse embryos. Mol Reprod Dev 45:264–275, 1996.[CrossRef][Medline]
  20. Ravnik SE, Rhee K, Wolgemuth DJ. Distinct patterns of expression of the D-type cyclins during testicular development in the mouse. Dev Gene 16:171–178, 1995.
  21. Bernier MP, Chatelain JP, Mather JP, Saez JM. Regulation of gonadotropin responsiveness and cell multiplication by somatomedin-C and insulin in cultured pig Leydig cells. J Cell Physiol 129:257–263, 1986.[CrossRef][Medline]
  22. McLaren A, Buehr M. Development of mouse germ cells in cultures of fetal gonads. Cell Differ Dev 44:153–158, 1990.
  23. Merchant-Larios H, Taketo T. Testicular differentiation in mammals under normal and experimental conditions. J Electron Microsc Technol 19:158–171, 1991.[CrossRef][Medline]
  24. Cailleau J, Vermeire S, Verhoeven G. Independent control of the production of the insulin-like growth factor-I and its binding proteins by cultured testicular cells. Mol Cell Endocrinol 69: 79–89, 1990.[CrossRef][Medline]
  25. Rouiller-Fabre V, Lecerf L, Gautier C, Saez J, Habert R. Expression and effect of the insulin-like growth factor 1 on rat fetal Leydig cell function and differentiation. Endocrinology 139: 2926–2934, 1998.[Abstract/Free Full Text]
  26. Taketo T, Seen CD, Koide S. Requirement of serum components for the preservation of the primordial germ cell in the testis cords during early stages of testicular differentiation in vitro in the mouse. Biol Reprod 34:919–924, 1981.
  27. Levy H, Deane HW, Rubin BL. Visualization of steroid 3ß-ol-deshidrogenase activity in tissues of intact and hypophysectomized rats. Endocrinology 65:932–943, 1959.[Medline]
  28. Pearse EAG. Histochemistry. London: J. & A. Churchill Ltd., 1961.
  29. Kruth HS, Braylan RC, Benson NA, Nourse VA. Simultaneous analysis of DNA and cell surface immunoglobulin in human B-cell lymphomas by flow cytometry. Cancer Res 41:4895–4899, 1981.[Abstract/Free Full Text]
  30. Cupp AS, Skinner MK. Embryonic Sertoli cell differentiation. In: Skinner MK, Grinswold MD Ed. Sertoli Cells. London: Elsevier, Academic Press:pp43–77, 2005.
  31. Burwen SJ, Jones AL. The association of polypeptide hormones and growth factors with the nuclei of target cells. TIBS 159:162–69, 1987.
  32. Peralta–Soler A, Alemany J, Smith MR, Pablo FD, Jarett L. The state of differentiation of embryonic chicken lens cells determines insulin-like growth factor internalization. Endocrinology 127:595–603, 1990.[Abstract/Free Full Text]
  33. Li W, Fawcett J, Widmer HR, Fielder JP, Rabkin R, Keller AG. Nuclear transport of the insulin-like growth factor-1 and insulin-like growth factor binding protein-3 in opossum kidney cells. Endocrinology 138:1763–1766, 1997.[Abstract/Free Full Text]
  34. Sun H, Tu X, Prisco M, Wu A, Casiburi I, Baserga R. Insulin-like growth factor I receptor signaling and nuclear translocation of insulin receptor substrate 1 and 2. Mol Endocrinol 17:472–486, 2003.[Abstract/Free Full Text]
  35. Elguin RG, Busby WH Jr, Clemmons DR. An insulin-like growth factor (IGF-1) binding protein enhances the biological response to IGF-I. Proc Natl Acad Sci U S A 84:3254–3258, 1987.[Abstract/Free Full Text]



This article has been cited by other articles:


Home page
 FASEB J.Home page
Y.-H. Huang, C.-C. Chin, H.-N. Ho, C.-K. Chou, C.-N. Shen, H.-C. Kuo, T.-J. Wu, Y.-C. Wu, Y.-C. Hung, C.-C. Chang, et al.
Pluripotency of mouse spermatogonial stem cells maintained by IGF-1- dependent pathway
FASEB J, July 1, 2009; 23(7): 2076 - 2087.
[Abstract] [Full Text] [PDF]

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF) Free
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Villalpando, I.
Right arrow Articles by Echeverria, O.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Villalpando, I.
Right arrow Articles by Echeverria, O.

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS